ID: 1038327036

View in Genome Browser
Species Human (GRCh38)
Location 8:26579170-26579192
Sequence CAGACAATGATCGCGGCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038327022_1038327036 28 Left 1038327022 8:26579119-26579141 CCGGGCGCTAATGGCGCTGCGCG 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1038327036 8:26579170-26579192 CAGACAATGATCGCGGCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038327036 Original CRISPR CAGACAATGATCGCGGCGGC CGG Intronic
No off target data available for this crispr