ID: 1038329734

View in Genome Browser
Species Human (GRCh38)
Location 8:26598637-26598659
Sequence TACTTTGTGCTGTAAGCTAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038329734_1038329736 3 Left 1038329734 8:26598637-26598659 CCGTTAGCTTACAGCACAAAGTA 0: 1
1: 0
2: 0
3: 8
4: 155
Right 1038329736 8:26598663-26598685 TGAAATAAAGATTGGCTCGCAGG No data
1038329734_1038329737 4 Left 1038329734 8:26598637-26598659 CCGTTAGCTTACAGCACAAAGTA 0: 1
1: 0
2: 0
3: 8
4: 155
Right 1038329737 8:26598664-26598686 GAAATAAAGATTGGCTCGCAGGG No data
1038329734_1038329735 -5 Left 1038329734 8:26598637-26598659 CCGTTAGCTTACAGCACAAAGTA 0: 1
1: 0
2: 0
3: 8
4: 155
Right 1038329735 8:26598655-26598677 AAGTACTTTGAAATAAAGATTGG No data
1038329734_1038329738 8 Left 1038329734 8:26598637-26598659 CCGTTAGCTTACAGCACAAAGTA 0: 1
1: 0
2: 0
3: 8
4: 155
Right 1038329738 8:26598668-26598690 TAAAGATTGGCTCGCAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038329734 Original CRISPR TACTTTGTGCTGTAAGCTAA CGG (reversed) Intronic
900826637 1:4932343-4932365 TACTTTATGCTGAAAGTTGATGG + Intergenic
901130007 1:6956296-6956318 TACTATGTGCTTGAAGCTCATGG + Intronic
903341507 1:22657803-22657825 CACTTTGTCCTGAGAGCTAATGG + Intronic
905892501 1:41526129-41526151 TCCTTTCAGCTGTAAGCTGATGG - Intronic
908953524 1:69592074-69592096 TACTTTGTGCTGCTTGCTATAGG + Intronic
913052385 1:115129131-115129153 CACTTTGTGCTCTAAGGTCAGGG + Intergenic
913223523 1:116678646-116678668 TAATTTGTGCTGTGAACTTAAGG - Intergenic
918687683 1:187439321-187439343 TTCTTTGTGGTGTGAGGTAAGGG + Intergenic
918913721 1:190607884-190607906 TTCTGTGTGCTTTAAGCTAAGGG - Intergenic
920866467 1:209757692-209757714 GACTTGGTGCTGTAAGACAAAGG - Intronic
923182655 1:231535808-231535830 TGCTTTGTTCTGTAAGGAAAAGG + Intronic
1064951735 10:20858992-20859014 AACATAGTGCTGAAAGCTAAAGG - Intronic
1065501466 10:26387005-26387027 TACTCTGTGCAGAAAGCTGAAGG - Intergenic
1066328359 10:34389900-34389922 TGATTTCTGCTGTAATCTAAAGG - Intronic
1066475217 10:35740117-35740139 TGCTTTGTGCTGGAATTTAAGGG - Intergenic
1067366358 10:45633105-45633127 TACTTTTTGCTGTAAGAAAGTGG - Intronic
1068937375 10:62649087-62649109 TACTTTGTTCTCTGAGCAAAGGG - Intronic
1069673408 10:70230220-70230242 CTCGTTGTGCTGTGAGCTAAAGG - Intronic
1070271698 10:74962748-74962770 TACTTTATGATGTAAGCAGAAGG - Intronic
1071461006 10:85895618-85895640 TACTGTGTGGTGTGAGCTGAGGG + Intronic
1072821677 10:98564579-98564601 TGCTTTGTGCTGTGAACTAGTGG - Intronic
1073102612 10:101014512-101014534 TACTTAGCGCTGGGAGCTAAGGG + Intronic
1074235051 10:111576661-111576683 TGCTGTGTGCTGTATGCCAATGG + Intergenic
1075396046 10:122127800-122127822 GACTTTGTGCTGTCAGCTCCGGG - Intronic
1076456815 10:130605605-130605627 TACCTTGTGCTGGAATTTAATGG + Intergenic
1080913877 11:36634940-36634962 TACTTAGTGGTGTATGCTAATGG - Intronic
1081711917 11:45222652-45222674 CCTTTTGTGCTGTAACCTAAAGG + Intronic
1085112772 11:73902658-73902680 TACTATTTACTCTAAGCTAAAGG - Intronic
1094067459 12:26376661-26376683 TACTTTATCCTGAAAGTTAAGGG - Intronic
1098204183 12:68089672-68089694 TACTTTTTGTTCTAAGATAATGG - Intergenic
1099251593 12:80262114-80262136 TCCTTTCTGCTGTAAACTTAGGG + Intronic
1099391422 12:82084752-82084774 TTCTATGTGCTGTGAGATAAAGG + Intergenic
1101163111 12:101999335-101999357 TAGTTTATGCTGAAAGATAATGG - Intronic
1102668321 12:114595940-114595962 TTGTTTATGCTGTAAGATAAGGG - Intergenic
1104074029 12:125373607-125373629 TACTTTGTAACGGAAGCTAAAGG - Intronic
1105448550 13:20478070-20478092 TACTTTCTGCTGTTAGCAATGGG - Intronic
1110089032 13:71421675-71421697 TTATTTGTGGTGTAAGATAAGGG + Intergenic
1110613239 13:77512289-77512311 TTCTTTGTGAGGAAAGCTAAGGG + Intergenic
1111014450 13:82359883-82359905 TACATTGTTCTGTCAGCTGATGG + Intergenic
1114774303 14:25463942-25463964 TGCTTTGTGATGTGAGTTAATGG + Intergenic
1116421290 14:44735741-44735763 TACTGGGTGCTGTAAGACAATGG - Intergenic
1118507448 14:66428962-66428984 TATTTTGGGCAGAAAGCTAATGG + Intergenic
1119233322 14:72998461-72998483 TCCTTTGAGCTGTTTGCTAAGGG - Intronic
1121973809 14:98383657-98383679 TACTCTGGGATGTAAGGTAAGGG + Intergenic
1124591477 15:31057524-31057546 TACTTTGTACTTTAAGTTCAGGG - Intronic
1125413835 15:39431948-39431970 TGCTTTGTGAGGTAAACTAATGG - Intergenic
1125519860 15:40342074-40342096 TTGTTTGTGTTTTAAGCTAAGGG + Intergenic
1126290442 15:47070542-47070564 TGCTCTCTGCAGTAAGCTAAGGG - Intergenic
1127679859 15:61282958-61282980 TACTGTGTGCCGTAAGCTGGTGG + Intergenic
1129873942 15:78960156-78960178 TACTTTGTGCTGGGATCTGAGGG - Exonic
1133503912 16:6391567-6391589 TTCTATTTGCTGTAAGCAAATGG + Intronic
1135305320 16:21362822-21362844 TCCTTTGTTCTGTAAGACAAAGG - Intergenic
1135825028 16:25719427-25719449 TACTTTTGGCTGTAAGCAAGAGG + Intronic
1136302063 16:29341970-29341992 TCCTTTGTTCTGTAAGACAAAGG - Intergenic
1138791308 16:59907102-59907124 TTATTTGTGCTGAAGGCTAAAGG - Intergenic
1147546165 17:41403221-41403243 TACTTTGTGTTGTATCCAAATGG - Intergenic
1151822509 17:76504343-76504365 TACTTTCTTCTGTAAGCAAGGGG + Intergenic
1153037567 18:778763-778785 TCCTTTGTGCTTTATGCTTAAGG - Intronic
1155810976 18:30234727-30234749 TACTTTGTGCTATTAGTAAAGGG - Intergenic
1155818241 18:30343402-30343424 TAATTAGTACTGTAAGCAAAAGG - Intergenic
1156098813 18:33568355-33568377 TTATGTGTGCTGTGAGCTAAAGG - Intergenic
1157740463 18:50088247-50088269 GACTTCATGCTGTAAGCTACTGG + Intronic
1158172876 18:54618884-54618906 TGCTTTGTGCTTTAAGATGATGG + Intergenic
1158786189 18:60713820-60713842 TACTTTGTACTGTAAGGTACTGG + Intergenic
925542661 2:4982750-4982772 TACTATGAGCTCTAAGCTCATGG - Intergenic
928423900 2:31162103-31162125 TCCATTGTGCTGGAAGCTCAAGG + Intergenic
930878643 2:56247804-56247826 TTCTTTGTCCTGTGATCTAAAGG - Intronic
934770201 2:96902841-96902863 TACATAATGCTGTAAGCCAATGG - Intronic
934808084 2:97254627-97254649 TAGTATGTGGTGTAAGTTAAGGG + Intronic
934829426 2:97502560-97502582 TAGTATGTGGTGTAAGTTAAGGG - Intronic
937696609 2:124815404-124815426 CATTTTGTGCTGAAAGCTGAAGG + Intronic
940502843 2:154516061-154516083 TAATTAGTGCACTAAGCTAAAGG + Intergenic
941656081 2:168146193-168146215 CAATTTGTTCTGTAAGCTCAAGG - Intronic
941792453 2:169567397-169567419 TAATTTGTACTGTTAGCAAAAGG + Intronic
941848480 2:170155374-170155396 TACTTGGTACTGATAGCTAAAGG - Intergenic
942154937 2:173118607-173118629 TACTTTATGCCGTAAGATCATGG - Intronic
942507904 2:176663112-176663134 TACTTTCTTCTGTAAGCCACTGG - Intergenic
943041139 2:182807029-182807051 TATTTTGTGCTGTAGACAAAGGG - Intergenic
947936362 2:234008152-234008174 TACTTTGAGCTTTCAGCTAGAGG + Intronic
948822503 2:240557294-240557316 GACTTCGTCCTCTAAGCTAAGGG + Exonic
1176011886 20:62901609-62901631 TGCTTGGTGCTGTCAGCTAGGGG - Intronic
1176269195 20:64226787-64226809 TACTCTCTGCTGTAAGCCACTGG + Intronic
1177337443 21:19749646-19749668 GCATTTGTGTTGTAAGCTAAAGG + Intergenic
1177697387 21:24591315-24591337 CACTTAGTGCTTTAAGCTAAAGG + Intergenic
1182122055 22:27794516-27794538 TGATTTCTCCTGTAAGCTAAAGG - Intronic
1184949394 22:47829561-47829583 TACTTTGAGCTGTATGTTTAGGG + Intergenic
950821893 3:15768809-15768831 TAAATTGTTCAGTAAGCTAAGGG + Intronic
951441680 3:22730874-22730896 AACTTTGTCCTGGAAGGTAAAGG - Intergenic
951750927 3:26035646-26035668 GACTTTGTGCTGTAAGACAAAGG - Intergenic
963526328 3:146419135-146419157 CACATTGTGCTATAAGCAAAAGG + Intronic
966461062 3:180176830-180176852 TGCTTTCTGCCATAAGCTAATGG + Intergenic
967377922 3:188826351-188826373 TATTTACTGCTGAAAGCTAATGG - Intronic
970074720 4:12204620-12204642 TCCTTTGTTCTGTAATCAAAAGG - Intergenic
970166334 4:13242083-13242105 TGCTTTGTCCTGGAAGCTAATGG - Intergenic
971458942 4:26873544-26873566 TACTTTGTCCAGGAAGCTCATGG + Intronic
971535743 4:27748456-27748478 TACTTTATAATGTAAACTAAAGG - Intergenic
974471446 4:62323942-62323964 AACTCTAAGCTGTAAGCTAAAGG + Intergenic
975073468 4:70173963-70173985 TACTTTGTCATGTCAGCTATTGG - Intronic
977256070 4:94741426-94741448 CACTGTGTGTTGTAAGATAAGGG + Intergenic
982030148 4:151292827-151292849 TACTTTAAGCTTTAAGCTACAGG + Intronic
984318377 4:178159148-178159170 TACTTTAAGCTGAAAGATAATGG + Intergenic
986044749 5:4026277-4026299 GTGTTTGTGCTTTAAGCTAAGGG - Intergenic
987948068 5:24640063-24640085 TACTTTGTGCTATAATGCAAAGG + Intronic
988205499 5:28128268-28128290 AACTTTTTGCTTTAGGCTAATGG + Intergenic
988563219 5:32299447-32299469 TGCTTTATGATTTAAGCTAACGG + Intronic
994090813 5:95808265-95808287 TCCCTTGTGCTGCCAGCTAAAGG + Intronic
998951631 5:147398379-147398401 TAATTTGTGCAGCAAGCGAATGG - Intronic
1002599314 5:180345334-180345356 TACTAGGTGCTGCAAGCTACTGG + Intronic
1002961412 6:1918335-1918357 TACTTGGTCTTATAAGCTAATGG + Intronic
1005857106 6:29870935-29870957 TTCATTGTGCTGAAAGCCAAAGG + Intergenic
1006720666 6:36147992-36148014 TACCTGGTGCTGTAAGCAAGAGG - Intergenic
1007746753 6:44047845-44047867 TACATTGTGATATAAGCCAAAGG - Intergenic
1007860134 6:44899862-44899884 GACTTTCTGCTGGAAACTAAGGG + Intronic
1010935618 6:81857833-81857855 GACTTTATTCTGTAAGCTATAGG - Intergenic
1012115605 6:95293989-95294011 TACTTTTACCTGTAAGCTTATGG + Intergenic
1014135975 6:117890456-117890478 AACTTGGTCCTGTAAGCTGATGG + Intergenic
1014237431 6:118974712-118974734 TACTTTCTGCTATAAGCTTCTGG + Intronic
1014412365 6:121141903-121141925 TGCTTTTTGCTATTAGCTAAAGG - Intronic
1014473431 6:121843971-121843993 TACTATGTGCTGTAAGTTGTAGG - Intergenic
1014665835 6:124236272-124236294 TAGATTGTGCTGTAATCAAAAGG + Intronic
1014839087 6:126196097-126196119 TACTTTGTTATTTAAGCCAATGG + Intergenic
1015373116 6:132478784-132478806 TACTTTTTGCTCTACCCTAAAGG + Intronic
1016060427 6:139624159-139624181 GACTTTGTTCTGTAGGCAAAAGG + Intergenic
1016348137 6:143138363-143138385 ATCTTTGTGCTTTATGCTAATGG - Intronic
1017925433 6:158908139-158908161 TTCTTCGTGCTGTATGCAAATGG + Intronic
1018303481 6:162428927-162428949 AAGTTTGAGCTGAAAGCTAAAGG - Intronic
1028672313 7:93416631-93416653 TTGTTTATGGTGTAAGCTAAGGG + Intergenic
1032678741 7:134159467-134159489 CACTTCGAGCTCTAAGCTAAGGG - Intronic
1037253584 8:16925540-16925562 TACCTTGTGCTGTTAACCAAAGG - Intergenic
1037854465 8:22360980-22361002 CTCTTTGTGCTGCAATCTAATGG - Intergenic
1038329734 8:26598637-26598659 TACTTTGTGCTGTAAGCTAACGG - Intronic
1040731217 8:50449289-50449311 TATTCTGTGCTGGCAGCTAAGGG - Intronic
1041516888 8:58710485-58710507 TACTGTGTGCTGCTAGCTCAGGG + Intergenic
1045254157 8:100505683-100505705 TACTGTGTCCTGGAAGCCAAAGG - Intergenic
1045396828 8:101769049-101769071 TGCTGTGGGCTGTGAGCTAAAGG + Intronic
1045758702 8:105576147-105576169 TACCGTGTGCTGTAAGATAGTGG - Intronic
1046192363 8:110813182-110813204 TACGTTGTGCAGAAAGCTCAGGG - Intergenic
1047536398 8:125724173-125724195 TATTTTCCCCTGTAAGCTAAGGG + Intergenic
1048897789 8:139009161-139009183 TTGTATGTGATGTAAGCTAAGGG - Intergenic
1050905326 9:10996005-10996027 TGCTTTCTGCTGTGAGCTATGGG + Intergenic
1052486869 9:29112574-29112596 TATTTTGTCATGTAATCTAAAGG - Intergenic
1052766754 9:32649377-32649399 TACTGTGAACTGTAAGCCAATGG + Intergenic
1055793740 9:79951565-79951587 AACTTTCTGGTGTAAGCTGACGG - Intergenic
1057092495 9:92271767-92271789 AACTTTGTCCTGTAAACTGAAGG + Intronic
1058414327 9:104770081-104770103 TACTTAGTGCTGAAAGTTAAGGG - Intronic
1059144745 9:111889220-111889242 TAGTTTATACTGTAACCTAAAGG + Intergenic
1059219446 9:112599562-112599584 TATTCTGTGCTGTATACTAATGG + Intronic
1187022226 X:15395712-15395734 TCTTTTCTGCTGTAATCTAAAGG + Intronic
1188079425 X:25818025-25818047 GACTTTATCCTGTAAGATAAAGG - Intergenic
1188202927 X:27315203-27315225 TTCTGTGTGATGTAAGGTAAGGG - Intergenic
1188830592 X:34891919-34891941 TACTTTGTTGAGTAAACTAAGGG - Intergenic
1189035448 X:37490241-37490263 TATTTGGTGCAGTAAGCAAAAGG + Intronic
1189882971 X:45511166-45511188 TACTTAGTGCTGAAAGTAAAAGG - Intergenic
1190491664 X:50988842-50988864 AACTTTGTGCTGCCACCTAATGG + Intergenic
1190641474 X:52484776-52484798 TTCTTGGTGCTGTGAGCTGAAGG - Intergenic
1190646198 X:52528089-52528111 TTCTTGGTGCTGTGAGCTGAAGG + Intergenic
1192656802 X:73002163-73002185 TACTTGGTGCTGGGGGCTAAGGG - Intergenic
1192665318 X:73080838-73080860 TACTTGGTGCTGGGGGCTAAGGG + Intergenic
1194322441 X:92466384-92466406 GACTTTTTTGTGTAAGCTAAAGG - Intronic
1195229604 X:102832615-102832637 TACTCTGTGCTCTGAGCAAACGG - Intergenic
1198536534 X:137591954-137591976 TACTGAGTATTGTAAGCTAAAGG - Intergenic
1199281943 X:146011628-146011650 AACTTTGTGTTTTAAGCTAAGGG + Intergenic
1199583433 X:149385252-149385274 TGCTTTGTGCTGTTAGGGAATGG - Intergenic
1200630598 Y:5579863-5579885 GACTTTTTTGTGTAAGCTAAAGG - Intronic