ID: 1038330498

View in Genome Browser
Species Human (GRCh38)
Location 8:26604499-26604521
Sequence TGCCTGCCTCATCTTGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038330492_1038330498 18 Left 1038330492 8:26604458-26604480 CCCAGCTGGGGAAAGAGGAGGTA 0: 1
1: 0
2: 3
3: 33
4: 309
Right 1038330498 8:26604499-26604521 TGCCTGCCTCATCTTGAGAGAGG No data
1038330491_1038330498 19 Left 1038330491 8:26604457-26604479 CCCCAGCTGGGGAAAGAGGAGGT 0: 1
1: 0
2: 2
3: 42
4: 446
Right 1038330498 8:26604499-26604521 TGCCTGCCTCATCTTGAGAGAGG No data
1038330493_1038330498 17 Left 1038330493 8:26604459-26604481 CCAGCTGGGGAAAGAGGAGGTAA 0: 1
1: 2
2: 1
3: 38
4: 306
Right 1038330498 8:26604499-26604521 TGCCTGCCTCATCTTGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038330498 Original CRISPR TGCCTGCCTCATCTTGAGAG AGG Intronic
No off target data available for this crispr