ID: 1038332643

View in Genome Browser
Species Human (GRCh38)
Location 8:26621410-26621432
Sequence AACCGGACCAGCTTTTGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038332643_1038332652 21 Left 1038332643 8:26621410-26621432 CCGCAGCAAAAGCTGGTCCGGTT No data
Right 1038332652 8:26621454-26621476 CTGCTTGACCTGATTGCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038332643 Original CRISPR AACCGGACCAGCTTTTGCTG CGG (reversed) Intronic