ID: 1038334303

View in Genome Browser
Species Human (GRCh38)
Location 8:26634130-26634152
Sequence CAGGCTAGAAACTCTGAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038334303_1038334307 -5 Left 1038334303 8:26634130-26634152 CCGCCCTCAGAGTTTCTAGCCTG 0: 1
1: 0
2: 2
3: 28
4: 199
Right 1038334307 8:26634148-26634170 GCCTGTGAGTTTCTAGTCCAGGG No data
1038334303_1038334306 -6 Left 1038334303 8:26634130-26634152 CCGCCCTCAGAGTTTCTAGCCTG 0: 1
1: 0
2: 2
3: 28
4: 199
Right 1038334306 8:26634147-26634169 AGCCTGTGAGTTTCTAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038334303 Original CRISPR CAGGCTAGAAACTCTGAGGG CGG (reversed) Intronic
900407250 1:2498171-2498193 CAGGCTGAGAACTCTGAGGAGGG - Intronic
901014132 1:6218040-6218062 CGGGCCAGACACGCTGAGGGAGG - Intronic
901454940 1:9357847-9357869 CAGGCAAGGAACTCTGAGAGAGG - Intronic
903218148 1:21854456-21854478 CATGCTAGAAACTGGGAGGGAGG + Intronic
903386204 1:22928595-22928617 CAGGCTGGAATCTCTCAGGCAGG + Intergenic
904252404 1:29234578-29234600 CAGGCAAGAAACTATGAGCAAGG - Intergenic
904703900 1:32376340-32376362 CAGAGTAGAGACTCTGAGGGAGG - Exonic
905018369 1:34792695-34792717 CAGGCCAGGATCTCTCAGGGTGG - Intronic
908022353 1:59911242-59911264 CAGAAGAGAACCTCTGAGGGAGG + Intronic
909933090 1:81520620-81520642 CAGGCAAGAGAGTCTGAAGGAGG - Intronic
910673926 1:89798937-89798959 AAGGCTAGAAACACAGAAGGAGG + Intronic
910765580 1:90779180-90779202 CTGGCTAGTATCTCTGAGGATGG - Intergenic
911054054 1:93695893-93695915 CAGGCTGGAAACTGTCAGAGAGG - Intronic
913477280 1:119250284-119250306 CAGGCTAGAAACCCTGGTGTAGG - Intergenic
914227140 1:145730020-145730042 TAGGCTTTAAACTCTGAGAGTGG + Intronic
915130731 1:153693735-153693757 CAGGGTAGCAAGGCTGAGGGAGG - Exonic
915620557 1:157080784-157080806 CTGGAGAGAAACTCTGACGGTGG - Intergenic
916553700 1:165874592-165874614 CAGGCTAAGAAATCTGAGAGTGG - Intronic
916679479 1:167090838-167090860 CAGAATATAAACTCTGAAGGGGG - Intergenic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
923787615 1:237083385-237083407 AAGGCTAGAAGTGCTGAGGGAGG - Intronic
1062787874 10:280336-280358 CAGGTCAGAAACCCTGAGGGAGG - Intronic
1063097621 10:2922187-2922209 CAAGCAAGAAACGCTGAGTGTGG + Intergenic
1063754317 10:8989000-8989022 CAGGATAGATACTTTGAGGGTGG + Intergenic
1065137265 10:22684131-22684153 CAGGCCTGAAACTGTGAGTGGGG - Intronic
1065896811 10:30170279-30170301 AAGGCAGGAAACTCGGAGGGAGG + Intergenic
1066465081 10:35643150-35643172 CAGGCTGGAAACTCTGGGGCTGG + Intergenic
1067712567 10:48661732-48661754 CAGGCAAGGACCTCTCAGGGAGG - Intergenic
1069317424 10:67124049-67124071 CAGCCCAGGAACTCTAAGGGTGG + Intronic
1069620572 10:69835016-69835038 CTGGCTAGAAGCACTGAGGTGGG + Intronic
1069992016 10:72321840-72321862 CAGGCTAGAAACCTTGGGGGCGG - Intergenic
1070564274 10:77591545-77591567 CAACTTAGAAACTCTGAGGGTGG + Intronic
1071749039 10:88454016-88454038 CAGACTAGAAACTATGGGAGTGG + Intronic
1073442479 10:103560599-103560621 CATGCCAGGAACTCTGTGGGAGG + Intronic
1076334390 10:129695786-129695808 CAGGCGAGGAGCTCAGAGGGCGG + Intronic
1077225469 11:1437452-1437474 CAGGCTTGCATGTCTGAGGGAGG + Intronic
1080740760 11:35062633-35062655 CAGGCTTTAAACTCTAGGGGTGG - Intergenic
1083692125 11:64415782-64415804 CAGGTTAGAAACCCTGAGTTAGG - Intergenic
1084512551 11:69615383-69615405 CAGGCAAGAGACTATGAGGATGG + Intergenic
1084578745 11:70008983-70009005 CTGCCTGGAAACTCTGAGGCTGG - Intergenic
1084688746 11:70712523-70712545 CAGGACAGAAACTATGAGGGTGG + Intronic
1084991733 11:72931970-72931992 CAGGTTAGAAAGTCAGAGGAGGG - Intronic
1085081889 11:73641766-73641788 CAAGCTGGAAACTCTCAGGCTGG + Intergenic
1086903280 11:92391341-92391363 CAAGCTAGAAACACTTGGGGAGG - Intronic
1088792457 11:113237731-113237753 CTGGTTAGAAACTCAGAGGGGGG - Intronic
1089199565 11:116715624-116715646 CAGGAGACAAACACTGAGGGTGG + Intergenic
1091022944 11:132117339-132117361 CAGACTGGAAACTCTGAGCATGG + Intronic
1091472085 12:737770-737792 CAGGATAGACATCCTGAGGGAGG - Intergenic
1092950433 12:13498555-13498577 CAGGAAAGACACTCTGAGGGAGG - Intergenic
1096369873 12:51060091-51060113 AAGGCTAGAAACATTGAGGAAGG - Exonic
1096787553 12:54026194-54026216 GAGGCTGGGAACTCTGAGAGAGG + Intronic
1097211281 12:57372388-57372410 CAGGCTAGAAAGCCTTGGGGCGG + Intronic
1098971478 12:76861626-76861648 TGGCCCAGAAACTCTGAGGGTGG + Intronic
1099806396 12:87525994-87526016 CAGGCTAGAACCTCTGTGGTAGG - Intergenic
1100125409 12:91418703-91418725 CAGGCTGGAAAATCTCAGGCAGG + Intergenic
1100155733 12:91798350-91798372 CAAATTAGAAACTCTGGGGGTGG + Intergenic
1100442452 12:94629319-94629341 CAGTCTAGAGTCTCTCAGGGTGG + Intronic
1103304545 12:119953545-119953567 CAGGTTTGATACACTGAGGGAGG + Intergenic
1103406320 12:120678117-120678139 CAGCCCTGAAACTCTGAGGTGGG - Intergenic
1104297185 12:127527338-127527360 TAGAACAGAAACTCTGAGGGTGG + Intergenic
1104357956 12:128104811-128104833 CAGGCTGGAAACTCTCAGGCAGG - Intergenic
1105396815 13:20043933-20043955 CAGGGTAGAAGCTATGATGGGGG + Intronic
1108741283 13:53341330-53341352 CAGGCTAGAAACTCCCAGGCAGG - Intergenic
1109561613 13:64057095-64057117 TAGTCTAGAAACTCTGAGTAAGG + Intergenic
1110164584 13:72424260-72424282 CAACCTACAAACACTGAGGGAGG - Intergenic
1110196394 13:72793447-72793469 CAAGTCAGAAACTCTGAGGGTGG - Intronic
1110676389 13:78251004-78251026 CAGACTGGAAACTCTCAGGCAGG + Intergenic
1110952906 13:81517916-81517938 CAGGTTAGGAACCCTGTGGGGGG + Intergenic
1111300796 13:86347876-86347898 CAGGTTAGAAACTTTTAGGCTGG - Intergenic
1114555771 14:23561484-23561506 AAGGCTAGAAACTCTGGGGTAGG - Intronic
1115310196 14:31971704-31971726 CAGGCTGGAAACGCTCAGGCAGG + Intergenic
1116689794 14:48090920-48090942 CAGGCTTGAAACTTTTAGGCAGG + Intergenic
1118238047 14:64028806-64028828 CAGGCAGGAAGATCTGAGGGAGG - Intronic
1118630478 14:67697851-67697873 CAGTATATAAACTCTGAGTGTGG - Intergenic
1119137048 14:72230664-72230686 CAGGCTGGAAACTCTCAGGCAGG + Intronic
1119151531 14:72364461-72364483 ATGGCTAGAAAGTCTGATGGAGG - Intronic
1119338521 14:73854851-73854873 CAGGCAAGAATCTTTAAGGGTGG - Intronic
1119413612 14:74455108-74455130 CAGGCTGGAAACTCTCAGGCAGG - Intergenic
1119693647 14:76695785-76695807 CAGGGAAGAAACCCTGAGGAGGG - Intergenic
1120342472 14:83238830-83238852 TAGGCTAGCAACTCTAAGAGGGG - Intergenic
1122695688 14:103551040-103551062 CAGCCGAGACACTCTGTGGGAGG - Intergenic
1123775400 15:23574529-23574551 CAGGAGAGGAAATCTGAGGGGGG + Intronic
1124600322 15:31128329-31128351 CAGGCTAGAAAATGTGGGAGGGG - Intronic
1127367545 15:58305854-58305876 CAGGCTACAATCTCTGGGGTGGG - Intronic
1130172928 15:81535478-81535500 CAGGGTAGAAACCATGAGAGTGG - Intergenic
1130763977 15:86851632-86851654 CACTCTAGAGACTCTGAGGATGG - Intronic
1134536527 16:15030908-15030930 CATTCTAGAATCTCTGGGGGTGG - Intronic
1134776506 16:16858295-16858317 CAGGGAAGAAACTGGGAGGGTGG - Intergenic
1135789963 16:25384776-25384798 CAGGAGAGAAAGTGTGAGGGAGG - Intergenic
1140135877 16:72205078-72205100 CAGCCTAGACACACTGAGGATGG - Intergenic
1143332526 17:6148278-6148300 GAGGCTAGACACTTTGTGGGGGG - Intergenic
1145813006 17:27776011-27776033 CCTGATAGAAACTCTGATGGAGG + Intronic
1146625190 17:34430060-34430082 CAGAGTAGAAACTCGGACGGTGG + Intergenic
1147016116 17:37492811-37492833 CTGGCTAGGACCTCTGGGGGAGG - Intronic
1147149241 17:38504463-38504485 CAGGCTGTGAGCTCTGAGGGTGG + Intronic
1148017305 17:44531092-44531114 CAGACTGGAAACTCTCAGGCAGG - Intergenic
1152737346 17:82004026-82004048 GACGCTGGAAACTCTGAGGTTGG + Intronic
1155366692 18:25056207-25056229 CAGGATAGAAAATCAGAGGATGG - Intergenic
1155865196 18:30956317-30956339 CAGGTTAGAAACATTAAGGGAGG - Intergenic
1158693858 18:59685620-59685642 CATGCCAGAAACTCTGGAGGTGG - Intronic
1161114421 19:2488855-2488877 CTGGCCAGACACTCTGGGGGTGG + Intergenic
1163611632 19:18304757-18304779 CAGGCGAGAAGGTCTGGGGGCGG + Intergenic
1164736857 19:30548118-30548140 CAGGCCAGACATCCTGAGGGGGG + Exonic
1166756513 19:45195609-45195631 CAAGAGAGAAACTCTGAGGAAGG - Intronic
1166970808 19:46566188-46566210 CAGGCTGGAAACTCTCAGGCAGG - Intronic
1167475780 19:49700290-49700312 CAAGCCAGAATCTCTCAGGGTGG - Intronic
1168404106 19:56101994-56102016 CGGGGTAGAAACTATGATGGGGG - Intronic
925554069 2:5110028-5110050 AAGGCTAATAACTGTGAGGGAGG - Intergenic
932281749 2:70498911-70498933 CATACTAGAATCTCTGGGGGAGG + Intronic
934231844 2:90190677-90190699 CAGGCTTGTAACCCTGTGGGAGG - Intergenic
935316344 2:101838215-101838237 CAGACCAGAAACTTTGAGGTTGG - Intronic
937272237 2:120660418-120660440 CAGGAGAGAATCTCTGAGGTGGG + Intergenic
938670933 2:133586230-133586252 CAGGCTGGACCCTCTGAGGGAGG - Intergenic
938771103 2:134501652-134501674 CAGGCTAGCAAGTCTGATGGAGG + Intronic
940717969 2:157249350-157249372 CAGGCTCAAAACATTGAGGGAGG - Intergenic
940992364 2:160110763-160110785 CAGACTAGAAAATCCCAGGGTGG - Intronic
941069029 2:160935534-160935556 CAGGCTGGAAACTCTCAGGCAGG + Intergenic
941123267 2:161556218-161556240 CAGGCTTGAACATTTGAGGGAGG - Intronic
942232597 2:173874047-173874069 CAGGAAAGAGACTCTGAGAGGGG + Intergenic
943942705 2:194020244-194020266 CAGGCTGGCCACTCTGAGTGTGG - Intergenic
946743658 2:222825250-222825272 CAGGGTAGAAACTCAGTGGCTGG + Intergenic
1169868355 20:10224670-10224692 AAGGCAAGCAATTCTGAGGGGGG - Intronic
1170630825 20:18063353-18063375 CAGTGTAGAAAATCTGAGTGTGG + Intergenic
1171178709 20:23075346-23075368 CAAGTCAGAAGCTCTGAGGGAGG + Intergenic
1172594580 20:36141607-36141629 CAGGCCAGAAGCTTTGAGAGAGG + Intronic
1173410196 20:42803295-42803317 TAGACCAGAAACTCTGAGTGGGG + Intronic
1173457166 20:43212430-43212452 AAGGCAAGAAATTCTGAGTGGGG - Intergenic
1176364962 21:6027183-6027205 GAGGCTGGAAACTCTCAGGCTGG + Intergenic
1177721357 21:24910810-24910832 CAGGCTGGAAACTCTCAGACAGG - Intergenic
1179758556 21:43511362-43511384 GAGGCTGGAAACTCTCAGGCTGG - Intergenic
1180611229 22:17099491-17099513 CAGGCCAGAAACTCTTAGGGTGG + Intronic
1180990406 22:19932391-19932413 CAGGCTAAAAAGGCTGAGAGTGG - Intronic
1183253082 22:36744032-36744054 CAGGCCAGAGACCCTGAGGTGGG - Intergenic
1185390480 22:50558487-50558509 AAGGGTAGAGATTCTGAGGGAGG + Intronic
949578531 3:5362839-5362861 CAGGGTACTAACTTTGAGGGAGG + Intergenic
949692809 3:6660562-6660584 AAGGCTAGAAACTCAGACAGTGG - Intergenic
949711750 3:6878857-6878879 TAATCCAGAAACTCTGAGGGTGG - Intronic
950576412 3:13834690-13834712 AAGGCTAGAAGCACTGAGGAAGG - Intronic
950808338 3:15627672-15627694 TAGGCTAGAAACACTGACGCTGG - Intronic
951049875 3:18082328-18082350 CTTGTTAGAAACTCTGGGGGTGG + Intronic
952827555 3:37536987-37537009 CTGACTAGAAACTCTGAAGGTGG + Intronic
954457959 3:50610224-50610246 CAGGCTGGAACCTCTGTGGGTGG + Intronic
955741597 3:62096753-62096775 CTGTCCTGAAACTCTGAGGGTGG - Intronic
957165886 3:76673343-76673365 CTGGCCAGAAACTCTGAGGGTGG - Intronic
957918885 3:86722760-86722782 CTGGTTAGAAACTCTGGAGGTGG + Intergenic
960028406 3:113033532-113033554 AAGGCTGGAAACTCTCAGGCAGG + Intergenic
960487586 3:118272083-118272105 TAAACCAGAAACTCTGAGGGTGG - Intergenic
960574961 3:119220455-119220477 TAGGTTATAAACTCTGAGGGCGG - Intronic
961349425 3:126290253-126290275 CAGGCTAGAATCTCATAGTGGGG + Intergenic
963357232 3:144224151-144224173 CTTGTTAGAAACTCTGAGGGTGG - Intergenic
966709153 3:182952359-182952381 TAGGTTTGAAAATCTGAGGGAGG - Intronic
969435687 4:7188034-7188056 CAGACCAGAAACTCTGGGGTAGG - Intergenic
970515446 4:16825049-16825071 CTGCCTAGGAAATCTGAGGGAGG + Intronic
970986774 4:22168094-22168116 CAGGCTGGAAACTCTAGGGTAGG + Intergenic
974446702 4:61993589-61993611 CAGGGTAGAAACAATGAAGGAGG - Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
982280219 4:153676563-153676585 CAGGGTAGAAACTATGAGTGGGG + Intergenic
983077748 4:163345436-163345458 CAGCCTGGAAATTCTGATGGTGG + Exonic
984538149 4:181002824-181002846 GAGACTAGAACCTGTGAGGGAGG - Intergenic
985887736 5:2693170-2693192 CAGGCTGGAAACTGTCAGGAAGG + Intergenic
988894282 5:35655235-35655257 CAGACCTGAAACTCTGGGGGTGG + Intronic
988920976 5:35942377-35942399 CAGGCTGGAAACTCTTGGGTGGG - Intergenic
992908244 5:81369711-81369733 CAGGCTAGAATTTCTAAAGGAGG - Intronic
995090494 5:108170293-108170315 CAAGCAAGAAAATCTGAGGCAGG + Intronic
995769891 5:115657172-115657194 CCTGGTAGAAAATCTGAGGGAGG + Intergenic
996964845 5:129295607-129295629 CAGGCTAGAAACTATGAAAATGG - Intergenic
997179813 5:131816492-131816514 CAGGCTGGAAACTCTTGGGCAGG - Intronic
997799147 5:136842487-136842509 CAGGTCAGAGACTCAGAGGGTGG - Intergenic
1000760416 5:165216518-165216540 TAACCCAGAAACTCTGAGGGTGG - Intergenic
1001342160 5:170857406-170857428 CAGGCTAGAAAAGCTGGGTGAGG + Intergenic
1003369776 6:5513051-5513073 CAGGCTGGAAAACCTGATGGAGG + Intronic
1004471097 6:15929764-15929786 CAGGTTGGAATCTCTGAGGCAGG + Intergenic
1005182971 6:23127326-23127348 CAGGCTAAAAAGTCAGAGTGAGG - Intergenic
1005813876 6:29535022-29535044 CAGCCTAGAACCTGTGAGGTGGG - Intergenic
1008330509 6:50239860-50239882 CTGGCCAGAAACTCTGTGGCTGG + Intergenic
1009901227 6:69810019-69810041 CAGACTGGAAACTCTCAGGCAGG + Intergenic
1011823047 6:91275057-91275079 CAGGGTGGAAAATGTGAGGGCGG + Intergenic
1012987157 6:105887316-105887338 CAGCCTGGGAACTGTGAGGGAGG + Intergenic
1015605855 6:134954089-134954111 AAGGCTAGAAAAACTGAGTGAGG + Intergenic
1016477140 6:144440071-144440093 TATGCTATAAATTCTGAGGGAGG + Intronic
1017782017 6:157722673-157722695 CAGGATAAAAACACTGAGTGAGG - Intronic
1017975306 6:159351963-159351985 AAGCATAGAAACTCTGAGGATGG - Intergenic
1018430937 6:163722400-163722422 CAGGCCTGAACCTCTGGGGGTGG + Intergenic
1019418674 7:938862-938884 CCATCTAGAAATTCTGAGGGAGG + Intronic
1020637510 7:10714326-10714348 GAGGCTCGAAACTCAGAAGGTGG - Intergenic
1020797252 7:12690956-12690978 CAAGCTAGAAAATCTTAGGATGG - Intergenic
1021801537 7:24311628-24311650 GAGGGTAGAAAGTCTTAGGGTGG - Intergenic
1022036012 7:26535311-26535333 CAGGCTGGAAACTCTCACTGAGG + Exonic
1022048956 7:26646420-26646442 CAGGCTGGAATCCTTGAGGGTGG + Exonic
1024453246 7:49573942-49573964 CAGGTTATAAACACTGGGGGAGG - Intergenic
1024609978 7:51055715-51055737 CTGGCCAGGAACTCTGGGGGAGG - Intronic
1026098947 7:67368946-67368968 CAGGGTAGAAAAAGTGAGGGAGG - Intergenic
1029271580 7:99380216-99380238 CCGGCTAGAATCCCTGAGGCAGG + Intronic
1029841102 7:103364210-103364232 CAGGCAAGACACTCTGTGCGCGG + Exonic
1030924011 7:115428674-115428696 AAGGCAAGAAACTCTGAATGAGG + Intergenic
1032063407 7:128744688-128744710 CAGGGTAGAAACTGTGGGTGAGG + Intronic
1032662375 7:133999013-133999035 GAGGGGAGAAACACTGAGGGAGG + Intronic
1033754500 7:144386900-144386922 CACTCTAGAATCTCTGTGGGTGG + Intergenic
1034552438 7:151830203-151830225 CAGGCTTGAAACTCTGTGCCTGG + Intronic
1037551242 8:19973954-19973976 CAGGCTTAAAACTCAAAGGGGGG - Intergenic
1038334303 8:26634130-26634152 CAGGCTAGAAACTCTGAGGGCGG - Intronic
1038459636 8:27705091-27705113 CAGGGTGGAAAGTGTGAGGGAGG - Intergenic
1040125861 8:43736966-43736988 CAGGTTAGAAACTCTGATTTTGG + Intergenic
1040652142 8:49461012-49461034 CAGGCTTGGCACTCTGGGGGTGG - Intergenic
1041609653 8:59830651-59830673 CAGTATAGAAACTATGAGTGGGG - Intergenic
1041943522 8:63416037-63416059 CAGGCTGGAAATTCTGAGGTAGG + Intergenic
1041956050 8:63558954-63558976 CCAGCTAGAAACTCTGTGGCTGG + Intergenic
1043179213 8:77063733-77063755 CTGCATAGAAACTATGAGGGTGG + Intergenic
1045362699 8:101447963-101447985 CACAATAGAATCTCTGAGGGTGG - Intergenic
1046116396 8:109789815-109789837 CAGGCTGGAAACTCTTGGGTAGG + Intergenic
1046566937 8:115914004-115914026 CAGGGAAGAAAATCTGAGGTAGG - Intergenic
1046771267 8:118118829-118118851 CAGGCTAGAAACCCTGAACCAGG - Intergenic
1048473702 8:134724737-134724759 CAGGCTAGAAGCTCTCAAAGGGG + Intergenic
1049536901 8:143186609-143186631 CAGGGTAGAGACGCTGAGGTAGG - Intergenic
1050275516 9:3994031-3994053 CAGTCAGCAAACTCTGAGGGTGG - Intronic
1056238983 9:84624621-84624643 CAGGCTGGAAACTCTTGGGCAGG - Intergenic
1056529415 9:87473690-87473712 CAGGCTGGAAACTCAGGGAGGGG + Intergenic
1057479292 9:95431995-95432017 CAGCCTAGAAATTCAGAGGCAGG - Intergenic
1057907483 9:98993865-98993887 CAGGCTGGAAAGGCTGAGGATGG - Intronic
1061163550 9:128909792-128909814 CAGGACAGAAACTGTGTGGGTGG + Intronic
1185483930 X:468183-468205 CAGGCTGGAGGCTCTGAAGGAGG - Intergenic
1189747673 X:44186838-44186860 CAGGCAAGAAACTCTGTGCCTGG - Intronic
1190292354 X:49001312-49001334 GAGGGGAGGAACTCTGAGGGAGG - Intronic
1190948115 X:55115531-55115553 GAGGCTCGAAACACAGAGGGGGG + Intronic
1196187983 X:112764764-112764786 CAGGCCAGAAACTCAGATGAGGG - Intergenic
1197871999 X:131069621-131069643 CAGGCCAGAAACACAGAGGACGG + Intronic
1198502240 X:137262253-137262275 CAGGCTGGAAACTCTTAGACAGG - Intergenic
1198728451 X:139701534-139701556 CAGGCTGGAAATTCTCAGGCAGG - Intronic
1199754983 X:150855465-150855487 CAGGAGAGAGACTGTGAGGGGGG + Intronic
1200068219 X:153515076-153515098 CAGGGGAGAAAATCTGAGGCAGG - Intergenic