ID: 1038340572

View in Genome Browser
Species Human (GRCh38)
Location 8:26682017-26682039
Sequence TCCTATTTCTGATATGTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038340572_1038340582 24 Left 1038340572 8:26682017-26682039 CCATTGACATATCAGAAATAGGA No data
Right 1038340582 8:26682064-26682086 TGCCTGCTTGTCCTAGGATTTGG No data
1038340572_1038340580 18 Left 1038340572 8:26682017-26682039 CCATTGACATATCAGAAATAGGA No data
Right 1038340580 8:26682058-26682080 CACTCCTGCCTGCTTGTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038340572 Original CRISPR TCCTATTTCTGATATGTCAA TGG (reversed) Intergenic
No off target data available for this crispr