ID: 1038340573

View in Genome Browser
Species Human (GRCh38)
Location 8:26682042-26682064
Sequence AGGAGTGGGAAGAGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038340573_1038340586 26 Left 1038340573 8:26682042-26682064 CCCTCCACCCTCTTCCCACTCCT No data
Right 1038340586 8:26682091-26682113 GTTGTTCTAGTGCAGGTTCTAGG No data
1038340573_1038340585 19 Left 1038340573 8:26682042-26682064 CCCTCCACCCTCTTCCCACTCCT No data
Right 1038340585 8:26682084-26682106 TGGTTGTGTTGTTCTAGTGCAGG No data
1038340573_1038340580 -7 Left 1038340573 8:26682042-26682064 CCCTCCACCCTCTTCCCACTCCT No data
Right 1038340580 8:26682058-26682080 CACTCCTGCCTGCTTGTCCTAGG No data
1038340573_1038340582 -1 Left 1038340573 8:26682042-26682064 CCCTCCACCCTCTTCCCACTCCT No data
Right 1038340582 8:26682064-26682086 TGCCTGCTTGTCCTAGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038340573 Original CRISPR AGGAGTGGGAAGAGGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr