ID: 1038340582

View in Genome Browser
Species Human (GRCh38)
Location 8:26682064-26682086
Sequence TGCCTGCTTGTCCTAGGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038340573_1038340582 -1 Left 1038340573 8:26682042-26682064 CCCTCCACCCTCTTCCCACTCCT No data
Right 1038340582 8:26682064-26682086 TGCCTGCTTGTCCTAGGATTTGG No data
1038340572_1038340582 24 Left 1038340572 8:26682017-26682039 CCATTGACATATCAGAAATAGGA No data
Right 1038340582 8:26682064-26682086 TGCCTGCTTGTCCTAGGATTTGG No data
1038340575_1038340582 -5 Left 1038340575 8:26682046-26682068 CCACCCTCTTCCCACTCCTGCCT No data
Right 1038340582 8:26682064-26682086 TGCCTGCTTGTCCTAGGATTTGG No data
1038340574_1038340582 -2 Left 1038340574 8:26682043-26682065 CCTCCACCCTCTTCCCACTCCTG No data
Right 1038340582 8:26682064-26682086 TGCCTGCTTGTCCTAGGATTTGG No data
1038340576_1038340582 -8 Left 1038340576 8:26682049-26682071 CCCTCTTCCCACTCCTGCCTGCT No data
Right 1038340582 8:26682064-26682086 TGCCTGCTTGTCCTAGGATTTGG No data
1038340577_1038340582 -9 Left 1038340577 8:26682050-26682072 CCTCTTCCCACTCCTGCCTGCTT No data
Right 1038340582 8:26682064-26682086 TGCCTGCTTGTCCTAGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038340582 Original CRISPR TGCCTGCTTGTCCTAGGATT TGG Intergenic
No off target data available for this crispr