ID: 1038340585

View in Genome Browser
Species Human (GRCh38)
Location 8:26682084-26682106
Sequence TGGTTGTGTTGTTCTAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038340578_1038340585 5 Left 1038340578 8:26682056-26682078 CCCACTCCTGCCTGCTTGTCCTA No data
Right 1038340585 8:26682084-26682106 TGGTTGTGTTGTTCTAGTGCAGG No data
1038340573_1038340585 19 Left 1038340573 8:26682042-26682064 CCCTCCACCCTCTTCCCACTCCT No data
Right 1038340585 8:26682084-26682106 TGGTTGTGTTGTTCTAGTGCAGG No data
1038340575_1038340585 15 Left 1038340575 8:26682046-26682068 CCACCCTCTTCCCACTCCTGCCT No data
Right 1038340585 8:26682084-26682106 TGGTTGTGTTGTTCTAGTGCAGG No data
1038340574_1038340585 18 Left 1038340574 8:26682043-26682065 CCTCCACCCTCTTCCCACTCCTG No data
Right 1038340585 8:26682084-26682106 TGGTTGTGTTGTTCTAGTGCAGG No data
1038340581_1038340585 -1 Left 1038340581 8:26682062-26682084 CCTGCCTGCTTGTCCTAGGATTT No data
Right 1038340585 8:26682084-26682106 TGGTTGTGTTGTTCTAGTGCAGG No data
1038340577_1038340585 11 Left 1038340577 8:26682050-26682072 CCTCTTCCCACTCCTGCCTGCTT No data
Right 1038340585 8:26682084-26682106 TGGTTGTGTTGTTCTAGTGCAGG No data
1038340576_1038340585 12 Left 1038340576 8:26682049-26682071 CCCTCTTCCCACTCCTGCCTGCT No data
Right 1038340585 8:26682084-26682106 TGGTTGTGTTGTTCTAGTGCAGG No data
1038340579_1038340585 4 Left 1038340579 8:26682057-26682079 CCACTCCTGCCTGCTTGTCCTAG No data
Right 1038340585 8:26682084-26682106 TGGTTGTGTTGTTCTAGTGCAGG No data
1038340583_1038340585 -5 Left 1038340583 8:26682066-26682088 CCTGCTTGTCCTAGGATTTGGTT No data
Right 1038340585 8:26682084-26682106 TGGTTGTGTTGTTCTAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038340585 Original CRISPR TGGTTGTGTTGTTCTAGTGC AGG Intergenic
No off target data available for this crispr