ID: 1038345051

View in Genome Browser
Species Human (GRCh38)
Location 8:26725062-26725084
Sequence ATTCAAGATGACATTTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37480
Summary {0: 120, 1: 8137, 2: 11204, 3: 10271, 4: 7748}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038345051_1038345065 21 Left 1038345051 8:26725062-26725084 CCCACCCAAATGTCATCTTGAAT 0: 120
1: 8137
2: 11204
3: 10271
4: 7748
Right 1038345065 8:26725106-26725128 GTGTCATGGGAGGGACCTGGTGG 0: 277
1: 965
2: 2779
3: 5347
4: 8057
1038345051_1038345067 25 Left 1038345051 8:26725062-26725084 CCCACCCAAATGTCATCTTGAAT 0: 120
1: 8137
2: 11204
3: 10271
4: 7748
Right 1038345067 8:26725110-26725132 CATGGGAGGGACCTGGTGGGAGG 0: 358
1: 1194
2: 2812
3: 4325
4: 5576
1038345051_1038345060 12 Left 1038345051 8:26725062-26725084 CCCACCCAAATGTCATCTTGAAT 0: 120
1: 8137
2: 11204
3: 10271
4: 7748
Right 1038345060 8:26725097-26725119 GATCCCCACGTGTCATGGGAGGG 0: 5
1: 232
2: 1511
3: 3200
4: 6087
1038345051_1038345058 8 Left 1038345051 8:26725062-26725084 CCCACCCAAATGTCATCTTGAAT 0: 120
1: 8137
2: 11204
3: 10271
4: 7748
Right 1038345058 8:26725093-26725115 CCACGATCCCCACGTGTCATGGG 0: 2
1: 13
2: 347
3: 1935
4: 3497
1038345051_1038345064 18 Left 1038345051 8:26725062-26725084 CCCACCCAAATGTCATCTTGAAT 0: 120
1: 8137
2: 11204
3: 10271
4: 7748
Right 1038345064 8:26725103-26725125 CACGTGTCATGGGAGGGACCTGG 0: 136
1: 833
2: 2254
3: 4551
4: 5157
1038345051_1038345056 7 Left 1038345051 8:26725062-26725084 CCCACCCAAATGTCATCTTGAAT 0: 120
1: 8137
2: 11204
3: 10271
4: 7748
Right 1038345056 8:26725092-26725114 CCCACGATCCCCACGTGTCATGG 0: 2
1: 21
2: 492
3: 2330
4: 3643
1038345051_1038345059 11 Left 1038345051 8:26725062-26725084 CCCACCCAAATGTCATCTTGAAT 0: 120
1: 8137
2: 11204
3: 10271
4: 7748
Right 1038345059 8:26725096-26725118 CGATCCCCACGTGTCATGGGAGG 0: 2
1: 14
2: 377
3: 2086
4: 4249
1038345051_1038345066 22 Left 1038345051 8:26725062-26725084 CCCACCCAAATGTCATCTTGAAT 0: 120
1: 8137
2: 11204
3: 10271
4: 7748
Right 1038345066 8:26725107-26725129 TGTCATGGGAGGGACCTGGTGGG 0: 442
1: 1330
2: 3684
3: 5420
4: 6963

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038345051 Original CRISPR ATTCAAGATGACATTTGGGT GGG (reversed) Intergenic
Too many off-targets to display for this crispr