ID: 1038345053

View in Genome Browser
Species Human (GRCh38)
Location 8:26725066-26725088
Sequence TACTATTCAAGATGACATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038345053_1038345058 4 Left 1038345053 8:26725066-26725088 CCCAAATGTCATCTTGAATAGTA No data
Right 1038345058 8:26725093-26725115 CCACGATCCCCACGTGTCATGGG No data
1038345053_1038345067 21 Left 1038345053 8:26725066-26725088 CCCAAATGTCATCTTGAATAGTA No data
Right 1038345067 8:26725110-26725132 CATGGGAGGGACCTGGTGGGAGG No data
1038345053_1038345068 28 Left 1038345053 8:26725066-26725088 CCCAAATGTCATCTTGAATAGTA No data
Right 1038345068 8:26725117-26725139 GGGACCTGGTGGGAGGTAATTGG No data
1038345053_1038345060 8 Left 1038345053 8:26725066-26725088 CCCAAATGTCATCTTGAATAGTA No data
Right 1038345060 8:26725097-26725119 GATCCCCACGTGTCATGGGAGGG No data
1038345053_1038345065 17 Left 1038345053 8:26725066-26725088 CCCAAATGTCATCTTGAATAGTA No data
Right 1038345065 8:26725106-26725128 GTGTCATGGGAGGGACCTGGTGG No data
1038345053_1038345066 18 Left 1038345053 8:26725066-26725088 CCCAAATGTCATCTTGAATAGTA No data
Right 1038345066 8:26725107-26725129 TGTCATGGGAGGGACCTGGTGGG No data
1038345053_1038345059 7 Left 1038345053 8:26725066-26725088 CCCAAATGTCATCTTGAATAGTA No data
Right 1038345059 8:26725096-26725118 CGATCCCCACGTGTCATGGGAGG No data
1038345053_1038345056 3 Left 1038345053 8:26725066-26725088 CCCAAATGTCATCTTGAATAGTA No data
Right 1038345056 8:26725092-26725114 CCCACGATCCCCACGTGTCATGG No data
1038345053_1038345064 14 Left 1038345053 8:26725066-26725088 CCCAAATGTCATCTTGAATAGTA No data
Right 1038345064 8:26725103-26725125 CACGTGTCATGGGAGGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038345053 Original CRISPR TACTATTCAAGATGACATTT GGG (reversed) Intergenic