ID: 1038345053

View in Genome Browser
Species Human (GRCh38)
Location 8:26725066-26725088
Sequence TACTATTCAAGATGACATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038345053_1038345058 4 Left 1038345053 8:26725066-26725088 CCCAAATGTCATCTTGAATAGTA No data
Right 1038345058 8:26725093-26725115 CCACGATCCCCACGTGTCATGGG 0: 2
1: 13
2: 347
3: 1935
4: 3497
1038345053_1038345066 18 Left 1038345053 8:26725066-26725088 CCCAAATGTCATCTTGAATAGTA No data
Right 1038345066 8:26725107-26725129 TGTCATGGGAGGGACCTGGTGGG 0: 442
1: 1330
2: 3684
3: 5420
4: 6963
1038345053_1038345056 3 Left 1038345053 8:26725066-26725088 CCCAAATGTCATCTTGAATAGTA No data
Right 1038345056 8:26725092-26725114 CCCACGATCCCCACGTGTCATGG 0: 2
1: 21
2: 492
3: 2330
4: 3643
1038345053_1038345059 7 Left 1038345053 8:26725066-26725088 CCCAAATGTCATCTTGAATAGTA No data
Right 1038345059 8:26725096-26725118 CGATCCCCACGTGTCATGGGAGG 0: 2
1: 14
2: 377
3: 2086
4: 4249
1038345053_1038345065 17 Left 1038345053 8:26725066-26725088 CCCAAATGTCATCTTGAATAGTA No data
Right 1038345065 8:26725106-26725128 GTGTCATGGGAGGGACCTGGTGG 0: 277
1: 965
2: 2779
3: 5347
4: 8057
1038345053_1038345067 21 Left 1038345053 8:26725066-26725088 CCCAAATGTCATCTTGAATAGTA No data
Right 1038345067 8:26725110-26725132 CATGGGAGGGACCTGGTGGGAGG 0: 358
1: 1194
2: 2812
3: 4325
4: 5576
1038345053_1038345068 28 Left 1038345053 8:26725066-26725088 CCCAAATGTCATCTTGAATAGTA No data
Right 1038345068 8:26725117-26725139 GGGACCTGGTGGGAGGTAATTGG 0: 51
1: 874
2: 3004
3: 5007
4: 5168
1038345053_1038345060 8 Left 1038345053 8:26725066-26725088 CCCAAATGTCATCTTGAATAGTA No data
Right 1038345060 8:26725097-26725119 GATCCCCACGTGTCATGGGAGGG 0: 5
1: 232
2: 1511
3: 3200
4: 6087
1038345053_1038345064 14 Left 1038345053 8:26725066-26725088 CCCAAATGTCATCTTGAATAGTA No data
Right 1038345064 8:26725103-26725125 CACGTGTCATGGGAGGGACCTGG 0: 136
1: 833
2: 2254
3: 4551
4: 5157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038345053 Original CRISPR TACTATTCAAGATGACATTT GGG (reversed) Intergenic
No off target data available for this crispr