ID: 1038345056

View in Genome Browser
Species Human (GRCh38)
Location 8:26725092-26725114
Sequence CCCACGATCCCCACGTGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038345052_1038345056 6 Left 1038345052 8:26725063-26725085 CCACCCAAATGTCATCTTGAATA No data
Right 1038345056 8:26725092-26725114 CCCACGATCCCCACGTGTCATGG No data
1038345053_1038345056 3 Left 1038345053 8:26725066-26725088 CCCAAATGTCATCTTGAATAGTA No data
Right 1038345056 8:26725092-26725114 CCCACGATCCCCACGTGTCATGG No data
1038345054_1038345056 2 Left 1038345054 8:26725067-26725089 CCAAATGTCATCTTGAATAGTAG No data
Right 1038345056 8:26725092-26725114 CCCACGATCCCCACGTGTCATGG No data
1038345050_1038345056 8 Left 1038345050 8:26725061-26725083 CCCCACCCAAATGTCATCTTGAA No data
Right 1038345056 8:26725092-26725114 CCCACGATCCCCACGTGTCATGG No data
1038345051_1038345056 7 Left 1038345051 8:26725062-26725084 CCCACCCAAATGTCATCTTGAAT No data
Right 1038345056 8:26725092-26725114 CCCACGATCCCCACGTGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038345056 Original CRISPR CCCACGATCCCCACGTGTCA TGG Intergenic