ID: 1038345057

View in Genome Browser
Species Human (GRCh38)
Location 8:26725093-26725115
Sequence CCCATGACACGTGGGGATCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038345057_1038345068 1 Left 1038345057 8:26725093-26725115 CCACGATCCCCACGTGTCATGGG No data
Right 1038345068 8:26725117-26725139 GGGACCTGGTGGGAGGTAATTGG 0: 51
1: 874
2: 3004
3: 5007
4: 5168
1038345057_1038345073 14 Left 1038345057 8:26725093-26725115 CCACGATCCCCACGTGTCATGGG No data
Right 1038345073 8:26725130-26725152 AGGTAATTGGATCATGGGGATGG 0: 19
1: 479
2: 3371
3: 6438
4: 7186
1038345057_1038345070 8 Left 1038345057 8:26725093-26725115 CCACGATCCCCACGTGTCATGGG No data
Right 1038345070 8:26725124-26725146 GGTGGGAGGTAATTGGATCATGG 0: 150
1: 3993
2: 9305
3: 11638
4: 10387
1038345057_1038345067 -6 Left 1038345057 8:26725093-26725115 CCACGATCCCCACGTGTCATGGG No data
Right 1038345067 8:26725110-26725132 CATGGGAGGGACCTGGTGGGAGG 0: 358
1: 1194
2: 2812
3: 4325
4: 5576
1038345057_1038345072 10 Left 1038345057 8:26725093-26725115 CCACGATCCCCACGTGTCATGGG No data
Right 1038345072 8:26725126-26725148 TGGGAGGTAATTGGATCATGGGG 0: 173
1: 5353
2: 10896
3: 12755
4: 11741
1038345057_1038345065 -10 Left 1038345057 8:26725093-26725115 CCACGATCCCCACGTGTCATGGG No data
Right 1038345065 8:26725106-26725128 GTGTCATGGGAGGGACCTGGTGG 0: 277
1: 965
2: 2779
3: 5347
4: 8057
1038345057_1038345071 9 Left 1038345057 8:26725093-26725115 CCACGATCCCCACGTGTCATGGG No data
Right 1038345071 8:26725125-26725147 GTGGGAGGTAATTGGATCATGGG 0: 174
1: 5218
2: 10596
3: 11887
4: 9849
1038345057_1038345066 -9 Left 1038345057 8:26725093-26725115 CCACGATCCCCACGTGTCATGGG No data
Right 1038345066 8:26725107-26725129 TGTCATGGGAGGGACCTGGTGGG 0: 442
1: 1330
2: 3684
3: 5420
4: 6963
1038345057_1038345074 15 Left 1038345057 8:26725093-26725115 CCACGATCCCCACGTGTCATGGG No data
Right 1038345074 8:26725131-26725153 GGTAATTGGATCATGGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038345057 Original CRISPR CCCATGACACGTGGGGATCG TGG (reversed) Intergenic
No off target data available for this crispr