ID: 1038345057

View in Genome Browser
Species Human (GRCh38)
Location 8:26725093-26725115
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038345057_1038345066 -9 Left 1038345057 8:26725093-26725115 CCACGATCCCCACGTGTCATGGG No data
Right 1038345066 8:26725107-26725129 TGTCATGGGAGGGACCTGGTGGG No data
1038345057_1038345065 -10 Left 1038345057 8:26725093-26725115 CCACGATCCCCACGTGTCATGGG No data
Right 1038345065 8:26725106-26725128 GTGTCATGGGAGGGACCTGGTGG No data
1038345057_1038345070 8 Left 1038345057 8:26725093-26725115 CCACGATCCCCACGTGTCATGGG No data
Right 1038345070 8:26725124-26725146 GGTGGGAGGTAATTGGATCATGG No data
1038345057_1038345071 9 Left 1038345057 8:26725093-26725115 CCACGATCCCCACGTGTCATGGG No data
Right 1038345071 8:26725125-26725147 GTGGGAGGTAATTGGATCATGGG No data
1038345057_1038345067 -6 Left 1038345057 8:26725093-26725115 CCACGATCCCCACGTGTCATGGG No data
Right 1038345067 8:26725110-26725132 CATGGGAGGGACCTGGTGGGAGG No data
1038345057_1038345068 1 Left 1038345057 8:26725093-26725115 CCACGATCCCCACGTGTCATGGG No data
Right 1038345068 8:26725117-26725139 GGGACCTGGTGGGAGGTAATTGG No data
1038345057_1038345073 14 Left 1038345057 8:26725093-26725115 CCACGATCCCCACGTGTCATGGG No data
Right 1038345073 8:26725130-26725152 AGGTAATTGGATCATGGGGATGG No data
1038345057_1038345074 15 Left 1038345057 8:26725093-26725115 CCACGATCCCCACGTGTCATGGG No data
Right 1038345074 8:26725131-26725153 GGTAATTGGATCATGGGGATGGG No data
1038345057_1038345072 10 Left 1038345057 8:26725093-26725115 CCACGATCCCCACGTGTCATGGG No data
Right 1038345072 8:26725126-26725148 TGGGAGGTAATTGGATCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038345057 Original CRISPR CCCATGACACGTGGGGATCG TGG (reversed) Intergenic