ID: 1038345062

View in Genome Browser
Species Human (GRCh38)
Location 8:26725101-26725123
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038345062_1038345073 6 Left 1038345062 8:26725101-26725123 CCCACGTGTCATGGGAGGGACCT No data
Right 1038345073 8:26725130-26725152 AGGTAATTGGATCATGGGGATGG No data
1038345062_1038345072 2 Left 1038345062 8:26725101-26725123 CCCACGTGTCATGGGAGGGACCT No data
Right 1038345072 8:26725126-26725148 TGGGAGGTAATTGGATCATGGGG No data
1038345062_1038345071 1 Left 1038345062 8:26725101-26725123 CCCACGTGTCATGGGAGGGACCT No data
Right 1038345071 8:26725125-26725147 GTGGGAGGTAATTGGATCATGGG No data
1038345062_1038345074 7 Left 1038345062 8:26725101-26725123 CCCACGTGTCATGGGAGGGACCT No data
Right 1038345074 8:26725131-26725153 GGTAATTGGATCATGGGGATGGG No data
1038345062_1038345070 0 Left 1038345062 8:26725101-26725123 CCCACGTGTCATGGGAGGGACCT No data
Right 1038345070 8:26725124-26725146 GGTGGGAGGTAATTGGATCATGG No data
1038345062_1038345068 -7 Left 1038345062 8:26725101-26725123 CCCACGTGTCATGGGAGGGACCT No data
Right 1038345068 8:26725117-26725139 GGGACCTGGTGGGAGGTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038345062 Original CRISPR AGGTCCCTCCCATGACACGT GGG (reversed) Intergenic