ID: 1038345062

View in Genome Browser
Species Human (GRCh38)
Location 8:26725101-26725123
Sequence AGGTCCCTCCCATGACACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17263
Summary {0: 102, 1: 793, 2: 2622, 3: 5620, 4: 8126}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038345062_1038345070 0 Left 1038345062 8:26725101-26725123 CCCACGTGTCATGGGAGGGACCT 0: 102
1: 793
2: 2622
3: 5620
4: 8126
Right 1038345070 8:26725124-26725146 GGTGGGAGGTAATTGGATCATGG 0: 150
1: 3993
2: 9305
3: 11638
4: 10387
1038345062_1038345068 -7 Left 1038345062 8:26725101-26725123 CCCACGTGTCATGGGAGGGACCT 0: 102
1: 793
2: 2622
3: 5620
4: 8126
Right 1038345068 8:26725117-26725139 GGGACCTGGTGGGAGGTAATTGG 0: 51
1: 874
2: 3004
3: 5007
4: 5168
1038345062_1038345071 1 Left 1038345062 8:26725101-26725123 CCCACGTGTCATGGGAGGGACCT 0: 102
1: 793
2: 2622
3: 5620
4: 8126
Right 1038345071 8:26725125-26725147 GTGGGAGGTAATTGGATCATGGG 0: 174
1: 5218
2: 10596
3: 11887
4: 9849
1038345062_1038345073 6 Left 1038345062 8:26725101-26725123 CCCACGTGTCATGGGAGGGACCT 0: 102
1: 793
2: 2622
3: 5620
4: 8126
Right 1038345073 8:26725130-26725152 AGGTAATTGGATCATGGGGATGG 0: 19
1: 479
2: 3371
3: 6438
4: 7186
1038345062_1038345074 7 Left 1038345062 8:26725101-26725123 CCCACGTGTCATGGGAGGGACCT 0: 102
1: 793
2: 2622
3: 5620
4: 8126
Right 1038345074 8:26725131-26725153 GGTAATTGGATCATGGGGATGGG No data
1038345062_1038345072 2 Left 1038345062 8:26725101-26725123 CCCACGTGTCATGGGAGGGACCT 0: 102
1: 793
2: 2622
3: 5620
4: 8126
Right 1038345072 8:26725126-26725148 TGGGAGGTAATTGGATCATGGGG 0: 173
1: 5353
2: 10896
3: 12755
4: 11741

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038345062 Original CRISPR AGGTCCCTCCCATGACACGT GGG (reversed) Intergenic
Too many off-targets to display for this crispr