ID: 1038345063

View in Genome Browser
Species Human (GRCh38)
Location 8:26725102-26725124
Sequence CAGGTCCCTCCCATGACACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038345063_1038345073 5 Left 1038345063 8:26725102-26725124 CCACGTGTCATGGGAGGGACCTG No data
Right 1038345073 8:26725130-26725152 AGGTAATTGGATCATGGGGATGG No data
1038345063_1038345072 1 Left 1038345063 8:26725102-26725124 CCACGTGTCATGGGAGGGACCTG No data
Right 1038345072 8:26725126-26725148 TGGGAGGTAATTGGATCATGGGG No data
1038345063_1038345068 -8 Left 1038345063 8:26725102-26725124 CCACGTGTCATGGGAGGGACCTG No data
Right 1038345068 8:26725117-26725139 GGGACCTGGTGGGAGGTAATTGG No data
1038345063_1038345071 0 Left 1038345063 8:26725102-26725124 CCACGTGTCATGGGAGGGACCTG No data
Right 1038345071 8:26725125-26725147 GTGGGAGGTAATTGGATCATGGG No data
1038345063_1038345074 6 Left 1038345063 8:26725102-26725124 CCACGTGTCATGGGAGGGACCTG No data
Right 1038345074 8:26725131-26725153 GGTAATTGGATCATGGGGATGGG No data
1038345063_1038345070 -1 Left 1038345063 8:26725102-26725124 CCACGTGTCATGGGAGGGACCTG No data
Right 1038345070 8:26725124-26725146 GGTGGGAGGTAATTGGATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038345063 Original CRISPR CAGGTCCCTCCCATGACACG TGG (reversed) Intergenic