ID: 1038345064

View in Genome Browser
Species Human (GRCh38)
Location 8:26725103-26725125
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038345053_1038345064 14 Left 1038345053 8:26725066-26725088 CCCAAATGTCATCTTGAATAGTA No data
Right 1038345064 8:26725103-26725125 CACGTGTCATGGGAGGGACCTGG No data
1038345052_1038345064 17 Left 1038345052 8:26725063-26725085 CCACCCAAATGTCATCTTGAATA No data
Right 1038345064 8:26725103-26725125 CACGTGTCATGGGAGGGACCTGG No data
1038345051_1038345064 18 Left 1038345051 8:26725062-26725084 CCCACCCAAATGTCATCTTGAAT No data
Right 1038345064 8:26725103-26725125 CACGTGTCATGGGAGGGACCTGG No data
1038345054_1038345064 13 Left 1038345054 8:26725067-26725089 CCAAATGTCATCTTGAATAGTAG No data
Right 1038345064 8:26725103-26725125 CACGTGTCATGGGAGGGACCTGG No data
1038345050_1038345064 19 Left 1038345050 8:26725061-26725083 CCCCACCCAAATGTCATCTTGAA No data
Right 1038345064 8:26725103-26725125 CACGTGTCATGGGAGGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038345064 Original CRISPR CACGTGTCATGGGAGGGACC TGG Intergenic