ID: 1038345065

View in Genome Browser
Species Human (GRCh38)
Location 8:26725106-26725128
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038345055_1038345065 -9 Left 1038345055 8:26725092-26725114 CCCACGATCCCCACGTGTCATGG No data
Right 1038345065 8:26725106-26725128 GTGTCATGGGAGGGACCTGGTGG No data
1038345057_1038345065 -10 Left 1038345057 8:26725093-26725115 CCACGATCCCCACGTGTCATGGG No data
Right 1038345065 8:26725106-26725128 GTGTCATGGGAGGGACCTGGTGG No data
1038345051_1038345065 21 Left 1038345051 8:26725062-26725084 CCCACCCAAATGTCATCTTGAAT No data
Right 1038345065 8:26725106-26725128 GTGTCATGGGAGGGACCTGGTGG No data
1038345053_1038345065 17 Left 1038345053 8:26725066-26725088 CCCAAATGTCATCTTGAATAGTA No data
Right 1038345065 8:26725106-26725128 GTGTCATGGGAGGGACCTGGTGG No data
1038345054_1038345065 16 Left 1038345054 8:26725067-26725089 CCAAATGTCATCTTGAATAGTAG No data
Right 1038345065 8:26725106-26725128 GTGTCATGGGAGGGACCTGGTGG No data
1038345050_1038345065 22 Left 1038345050 8:26725061-26725083 CCCCACCCAAATGTCATCTTGAA No data
Right 1038345065 8:26725106-26725128 GTGTCATGGGAGGGACCTGGTGG No data
1038345052_1038345065 20 Left 1038345052 8:26725063-26725085 CCACCCAAATGTCATCTTGAATA No data
Right 1038345065 8:26725106-26725128 GTGTCATGGGAGGGACCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038345065 Original CRISPR GTGTCATGGGAGGGACCTGG TGG Intergenic