ID: 1038345067

View in Genome Browser
Species Human (GRCh38)
Location 8:26725110-26725132
Sequence CATGGGAGGGACCTGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 14265
Summary {0: 358, 1: 1194, 2: 2812, 3: 4325, 4: 5576}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038345050_1038345067 26 Left 1038345050 8:26725061-26725083 CCCCACCCAAATGTCATCTTGAA 0: 106
1: 8136
2: 11485
3: 9529
4: 7124
Right 1038345067 8:26725110-26725132 CATGGGAGGGACCTGGTGGGAGG 0: 358
1: 1194
2: 2812
3: 4325
4: 5576
1038345057_1038345067 -6 Left 1038345057 8:26725093-26725115 CCACGATCCCCACGTGTCATGGG No data
Right 1038345067 8:26725110-26725132 CATGGGAGGGACCTGGTGGGAGG 0: 358
1: 1194
2: 2812
3: 4325
4: 5576
1038345055_1038345067 -5 Left 1038345055 8:26725092-26725114 CCCACGATCCCCACGTGTCATGG No data
Right 1038345067 8:26725110-26725132 CATGGGAGGGACCTGGTGGGAGG 0: 358
1: 1194
2: 2812
3: 4325
4: 5576
1038345053_1038345067 21 Left 1038345053 8:26725066-26725088 CCCAAATGTCATCTTGAATAGTA No data
Right 1038345067 8:26725110-26725132 CATGGGAGGGACCTGGTGGGAGG 0: 358
1: 1194
2: 2812
3: 4325
4: 5576
1038345054_1038345067 20 Left 1038345054 8:26725067-26725089 CCAAATGTCATCTTGAATAGTAG No data
Right 1038345067 8:26725110-26725132 CATGGGAGGGACCTGGTGGGAGG 0: 358
1: 1194
2: 2812
3: 4325
4: 5576
1038345051_1038345067 25 Left 1038345051 8:26725062-26725084 CCCACCCAAATGTCATCTTGAAT 0: 120
1: 8137
2: 11204
3: 10271
4: 7748
Right 1038345067 8:26725110-26725132 CATGGGAGGGACCTGGTGGGAGG 0: 358
1: 1194
2: 2812
3: 4325
4: 5576
1038345052_1038345067 24 Left 1038345052 8:26725063-26725085 CCACCCAAATGTCATCTTGAATA No data
Right 1038345067 8:26725110-26725132 CATGGGAGGGACCTGGTGGGAGG 0: 358
1: 1194
2: 2812
3: 4325
4: 5576

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038345067 Original CRISPR CATGGGAGGGACCTGGTGGG AGG Intergenic
Too many off-targets to display for this crispr