ID: 1038345068

View in Genome Browser
Species Human (GRCh38)
Location 8:26725117-26725139
Sequence GGGACCTGGTGGGAGGTAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 14104
Summary {0: 51, 1: 874, 2: 3004, 3: 5007, 4: 5168}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038345063_1038345068 -8 Left 1038345063 8:26725102-26725124 CCACGTGTCATGGGAGGGACCTG 0: 92
1: 666
2: 2004
3: 4781
4: 7410
Right 1038345068 8:26725117-26725139 GGGACCTGGTGGGAGGTAATTGG 0: 51
1: 874
2: 3004
3: 5007
4: 5168
1038345055_1038345068 2 Left 1038345055 8:26725092-26725114 CCCACGATCCCCACGTGTCATGG No data
Right 1038345068 8:26725117-26725139 GGGACCTGGTGGGAGGTAATTGG 0: 51
1: 874
2: 3004
3: 5007
4: 5168
1038345061_1038345068 -6 Left 1038345061 8:26725100-26725122 CCCCACGTGTCATGGGAGGGACC 0: 176
1: 1092
2: 2194
3: 3472
4: 4059
Right 1038345068 8:26725117-26725139 GGGACCTGGTGGGAGGTAATTGG 0: 51
1: 874
2: 3004
3: 5007
4: 5168
1038345057_1038345068 1 Left 1038345057 8:26725093-26725115 CCACGATCCCCACGTGTCATGGG No data
Right 1038345068 8:26725117-26725139 GGGACCTGGTGGGAGGTAATTGG 0: 51
1: 874
2: 3004
3: 5007
4: 5168
1038345062_1038345068 -7 Left 1038345062 8:26725101-26725123 CCCACGTGTCATGGGAGGGACCT 0: 102
1: 793
2: 2622
3: 5620
4: 8126
Right 1038345068 8:26725117-26725139 GGGACCTGGTGGGAGGTAATTGG 0: 51
1: 874
2: 3004
3: 5007
4: 5168
1038345053_1038345068 28 Left 1038345053 8:26725066-26725088 CCCAAATGTCATCTTGAATAGTA No data
Right 1038345068 8:26725117-26725139 GGGACCTGGTGGGAGGTAATTGG 0: 51
1: 874
2: 3004
3: 5007
4: 5168
1038345054_1038345068 27 Left 1038345054 8:26725067-26725089 CCAAATGTCATCTTGAATAGTAG No data
Right 1038345068 8:26725117-26725139 GGGACCTGGTGGGAGGTAATTGG 0: 51
1: 874
2: 3004
3: 5007
4: 5168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038345068 Original CRISPR GGGACCTGGTGGGAGGTAAT TGG Intergenic
Too many off-targets to display for this crispr