ID: 1038345071

View in Genome Browser
Species Human (GRCh38)
Location 8:26725125-26725147
Sequence GTGGGAGGTAATTGGATCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37724
Summary {0: 174, 1: 5218, 2: 10596, 3: 11887, 4: 9849}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038345062_1038345071 1 Left 1038345062 8:26725101-26725123 CCCACGTGTCATGGGAGGGACCT 0: 102
1: 793
2: 2622
3: 5620
4: 8126
Right 1038345071 8:26725125-26725147 GTGGGAGGTAATTGGATCATGGG 0: 174
1: 5218
2: 10596
3: 11887
4: 9849
1038345061_1038345071 2 Left 1038345061 8:26725100-26725122 CCCCACGTGTCATGGGAGGGACC 0: 176
1: 1092
2: 2194
3: 3472
4: 4059
Right 1038345071 8:26725125-26725147 GTGGGAGGTAATTGGATCATGGG 0: 174
1: 5218
2: 10596
3: 11887
4: 9849
1038345055_1038345071 10 Left 1038345055 8:26725092-26725114 CCCACGATCCCCACGTGTCATGG No data
Right 1038345071 8:26725125-26725147 GTGGGAGGTAATTGGATCATGGG 0: 174
1: 5218
2: 10596
3: 11887
4: 9849
1038345057_1038345071 9 Left 1038345057 8:26725093-26725115 CCACGATCCCCACGTGTCATGGG No data
Right 1038345071 8:26725125-26725147 GTGGGAGGTAATTGGATCATGGG 0: 174
1: 5218
2: 10596
3: 11887
4: 9849
1038345063_1038345071 0 Left 1038345063 8:26725102-26725124 CCACGTGTCATGGGAGGGACCTG 0: 92
1: 666
2: 2004
3: 4781
4: 7410
Right 1038345071 8:26725125-26725147 GTGGGAGGTAATTGGATCATGGG 0: 174
1: 5218
2: 10596
3: 11887
4: 9849

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038345071 Original CRISPR GTGGGAGGTAATTGGATCAT GGG Intergenic
Too many off-targets to display for this crispr