ID: 1038345073

View in Genome Browser
Species Human (GRCh38)
Location 8:26725130-26725152
Sequence AGGTAATTGGATCATGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038345062_1038345073 6 Left 1038345062 8:26725101-26725123 CCCACGTGTCATGGGAGGGACCT No data
Right 1038345073 8:26725130-26725152 AGGTAATTGGATCATGGGGATGG No data
1038345055_1038345073 15 Left 1038345055 8:26725092-26725114 CCCACGATCCCCACGTGTCATGG No data
Right 1038345073 8:26725130-26725152 AGGTAATTGGATCATGGGGATGG No data
1038345057_1038345073 14 Left 1038345057 8:26725093-26725115 CCACGATCCCCACGTGTCATGGG No data
Right 1038345073 8:26725130-26725152 AGGTAATTGGATCATGGGGATGG No data
1038345061_1038345073 7 Left 1038345061 8:26725100-26725122 CCCCACGTGTCATGGGAGGGACC No data
Right 1038345073 8:26725130-26725152 AGGTAATTGGATCATGGGGATGG No data
1038345063_1038345073 5 Left 1038345063 8:26725102-26725124 CCACGTGTCATGGGAGGGACCTG No data
Right 1038345073 8:26725130-26725152 AGGTAATTGGATCATGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038345073 Original CRISPR AGGTAATTGGATCATGGGGA TGG Intergenic