ID: 1038345074

View in Genome Browser
Species Human (GRCh38)
Location 8:26725131-26725153
Sequence GGTAATTGGATCATGGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038345055_1038345074 16 Left 1038345055 8:26725092-26725114 CCCACGATCCCCACGTGTCATGG No data
Right 1038345074 8:26725131-26725153 GGTAATTGGATCATGGGGATGGG No data
1038345061_1038345074 8 Left 1038345061 8:26725100-26725122 CCCCACGTGTCATGGGAGGGACC 0: 176
1: 1092
2: 2194
3: 3472
4: 4059
Right 1038345074 8:26725131-26725153 GGTAATTGGATCATGGGGATGGG No data
1038345062_1038345074 7 Left 1038345062 8:26725101-26725123 CCCACGTGTCATGGGAGGGACCT 0: 102
1: 793
2: 2622
3: 5620
4: 8126
Right 1038345074 8:26725131-26725153 GGTAATTGGATCATGGGGATGGG No data
1038345063_1038345074 6 Left 1038345063 8:26725102-26725124 CCACGTGTCATGGGAGGGACCTG 0: 92
1: 666
2: 2004
3: 4781
4: 7410
Right 1038345074 8:26725131-26725153 GGTAATTGGATCATGGGGATGGG No data
1038345057_1038345074 15 Left 1038345057 8:26725093-26725115 CCACGATCCCCACGTGTCATGGG No data
Right 1038345074 8:26725131-26725153 GGTAATTGGATCATGGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038345074 Original CRISPR GGTAATTGGATCATGGGGAT GGG Intergenic
No off target data available for this crispr