ID: 1038345188

View in Genome Browser
Species Human (GRCh38)
Location 8:26725930-26725952
Sequence TTCATCAGTACTGAGAGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038345181_1038345188 6 Left 1038345181 8:26725901-26725923 CCATGTAAACCACCCTGGCCTAC No data
Right 1038345188 8:26725930-26725952 TTCATCAGTACTGAGAGATGAGG No data
1038345182_1038345188 -3 Left 1038345182 8:26725910-26725932 CCACCCTGGCCTACCTGACCTTC No data
Right 1038345188 8:26725930-26725952 TTCATCAGTACTGAGAGATGAGG No data
1038345184_1038345188 -7 Left 1038345184 8:26725914-26725936 CCTGGCCTACCTGACCTTCATCA No data
Right 1038345188 8:26725930-26725952 TTCATCAGTACTGAGAGATGAGG No data
1038345183_1038345188 -6 Left 1038345183 8:26725913-26725935 CCCTGGCCTACCTGACCTTCATC No data
Right 1038345188 8:26725930-26725952 TTCATCAGTACTGAGAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038345188 Original CRISPR TTCATCAGTACTGAGAGATG AGG Intergenic
No off target data available for this crispr