ID: 1038345592

View in Genome Browser
Species Human (GRCh38)
Location 8:26729485-26729507
Sequence GCTGATGTACTATATCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038345592_1038345594 -1 Left 1038345592 8:26729485-26729507 CCTTCCAGATATAGTACATCAGC No data
Right 1038345594 8:26729507-26729529 CATAAACATAGTGATTCTCAAGG No data
1038345592_1038345595 0 Left 1038345592 8:26729485-26729507 CCTTCCAGATATAGTACATCAGC No data
Right 1038345595 8:26729508-26729530 ATAAACATAGTGATTCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038345592 Original CRISPR GCTGATGTACTATATCTGGA AGG (reversed) Intergenic
No off target data available for this crispr