ID: 1038347648

View in Genome Browser
Species Human (GRCh38)
Location 8:26747094-26747116
Sequence TGCCCAAGGGTGACACAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038347648_1038347653 4 Left 1038347648 8:26747094-26747116 CCAGGCTGTGTCACCCTTGGGCA No data
Right 1038347653 8:26747121-26747143 CCTCCACACCCCACCTGGTATGG No data
1038347648_1038347654 5 Left 1038347648 8:26747094-26747116 CCAGGCTGTGTCACCCTTGGGCA No data
Right 1038347654 8:26747122-26747144 CTCCACACCCCACCTGGTATGGG No data
1038347648_1038347658 13 Left 1038347648 8:26747094-26747116 CCAGGCTGTGTCACCCTTGGGCA No data
Right 1038347658 8:26747130-26747152 CCCACCTGGTATGGGTACCCTGG No data
1038347648_1038347651 -1 Left 1038347648 8:26747094-26747116 CCAGGCTGTGTCACCCTTGGGCA No data
Right 1038347651 8:26747116-26747138 AGACTCCTCCACACCCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038347648 Original CRISPR TGCCCAAGGGTGACACAGCC TGG (reversed) Intergenic
No off target data available for this crispr