ID: 1038347840

View in Genome Browser
Species Human (GRCh38)
Location 8:26748344-26748366
Sequence CAGCAGGGCTGGACGGATGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 242}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038347840 Original CRISPR CAGCAGGGCTGGACGGATGT TGG (reversed) Exonic
900995970 1:6123958-6123980 CAGCGGGGCTGGCAGGAGGTGGG + Exonic
902079730 1:13812855-13812877 GAGCAGGGCTGGAAGCATTTTGG - Intronic
903361783 1:22781520-22781542 CAGCAGGGCTTGAGGGATCCTGG - Intronic
905091974 1:35437082-35437104 CAGCAGGGCTGGTCTCTTGTGGG - Intronic
905104575 1:35557105-35557127 CGGCTGCGCTGGCCGGATGTTGG - Intronic
905869617 1:41395553-41395575 CGGCAGGGCTGGATGGAAGTGGG + Intergenic
906078976 1:43071253-43071275 CAGCAGGGCTGCAGGAAGGTGGG + Intergenic
906253641 1:44330956-44330978 AAGCAGGGCAGGATGGAGGTAGG + Intronic
906381048 1:45332379-45332401 CAGCAGCTCTGGTAGGATGTTGG - Exonic
907728143 1:57039571-57039593 CAGCAAGGCTGGACTGTTCTAGG + Intronic
908530353 1:65027961-65027983 CAGAATGGCTGGACAGCTGTTGG - Intergenic
908678752 1:66635222-66635244 CAGCAGGGCTGCATGCATGAAGG + Intronic
908772156 1:67607142-67607164 AAGCAGAGCTGGATGGATGTAGG + Intergenic
913957631 1:143319319-143319341 GAGCAGGGCTGGACCAACGTTGG + Intergenic
914051942 1:144144683-144144705 GAGCAGGGCTGGACCAACGTTGG + Intergenic
914127255 1:144821858-144821880 GAGCAGGGCTGGACCAACGTTGG - Intergenic
916420960 1:164637401-164637423 CAGCGGGGCTGGTCGGACGGTGG + Intronic
919738793 1:200970318-200970340 CAGCAGGGCTGGACAGCTGAGGG + Intronic
920273764 1:204788188-204788210 GAGCAAGGCTGGACAGAGGTGGG + Intergenic
921075569 1:211697808-211697830 CAGGAGGGCTGCAGGCATGTAGG + Intergenic
921819447 1:219600599-219600621 CAGCAAGGCTGGAGGGGAGTGGG + Intergenic
922657039 1:227394354-227394376 CACCACGCCTGGACGGATTTGGG + Intergenic
1063117419 10:3081526-3081548 CAGCAGCGCTGCATGGCTGTGGG + Intronic
1064625211 10:17254394-17254416 CTGCAGGCCTGGACTGATGGTGG - Intergenic
1065746811 10:28849490-28849512 CTGCAGGGATGGATGGAGGTAGG + Intronic
1067041317 10:42954675-42954697 CATCAGGGCTGGAATGGTGTGGG - Intergenic
1067082518 10:43219587-43219609 CTCCAGGGCTGGCTGGATGTGGG - Intronic
1067563672 10:47321706-47321728 CAGCTGGGATGCAGGGATGTGGG + Intergenic
1067577936 10:47419674-47419696 GAGCAGGGCTGGATGGGGGTGGG - Intergenic
1067577956 10:47419740-47419762 GAGCAGGGCTGGATGGGGGTGGG - Intergenic
1067577975 10:47419806-47419828 GAGCAGGGCTGGATGGGGGTGGG - Intergenic
1067761969 10:49055191-49055213 CAGGGGGCCTGGAAGGATGTTGG - Intronic
1069785285 10:70983900-70983922 AAGCTGGGATGGACGGAAGTGGG + Intergenic
1070806912 10:79276116-79276138 CTGCAGGGAGGGACGGATGGGGG - Intronic
1071450181 10:85786578-85786600 CAGCAGGGTGGGAGGGATGTCGG - Intronic
1071497817 10:86180722-86180744 GAGCAGGGCTGGACAGAGGGAGG + Intronic
1072736980 10:97885762-97885784 CATCAGGGCTGAGCAGATGTGGG + Intronic
1074440680 10:113475042-113475064 CAGCAGTGGTGGAGGGAGGTGGG + Intergenic
1076364645 10:129914191-129914213 GTGCAGGGCTGGAGGGAGGTGGG - Intronic
1076818274 10:132925300-132925322 CAGCAGGGCTTGTGGGAGGTGGG - Intronic
1076847328 10:133075682-133075704 CAGCAGGGCTGGCAGGAGGCTGG + Intronic
1077074795 11:695448-695470 CGACAGGGCTGGACGGCTCTAGG + Exonic
1077217470 11:1400938-1400960 CAGCAGGGATGGAAGGAAGGAGG - Intronic
1077280289 11:1741626-1741648 GAGCAGGGGTGGGCAGATGTGGG + Intronic
1077499947 11:2904797-2904819 GAGCAGGGCTGGAAGGAAGCAGG + Intronic
1078539382 11:12200922-12200944 GAGCAGGGGTAGAAGGATGTGGG - Intronic
1083202658 11:61129890-61129912 CTGCCGGGCTGGCGGGATGTCGG - Intergenic
1083717049 11:64583493-64583515 CAGCAGGGCTGGCCGAATCCAGG - Intergenic
1083854154 11:65384120-65384142 CAGCAAGGCTGTAGGGAAGTGGG - Intergenic
1084569282 11:69949743-69949765 CAGAAGGGCTGGAAGGAGGCAGG + Intergenic
1086856111 11:91868060-91868082 CAGCAGGGCTGGGCAGAAGGAGG - Intergenic
1088791920 11:113233684-113233706 AAGCAGGACTGGCCGGGTGTCGG - Intronic
1089214715 11:116828875-116828897 CAGCAGGGATGGCAGGATGAGGG - Intergenic
1089353069 11:117832271-117832293 AGGCAGGGCTGGAAGGAGGTGGG + Intronic
1091437165 12:481703-481725 CAGCTGGGCTGGATGGCTGGGGG + Intronic
1091676286 12:2493134-2493156 CAGCAGGGAGGGAGAGATGTGGG - Intronic
1091725896 12:2846178-2846200 GAGCAGGGCTGGAAGGTGGTGGG + Intronic
1092727517 12:11500005-11500027 CTGCAGGTCTGGTGGGATGTGGG - Intronic
1094180193 12:27584376-27584398 CAGGAGGGCTGAACTGATGCAGG + Intronic
1102338085 12:112099679-112099701 CAGCAGGCCTGGACACATGCAGG + Intronic
1103937891 12:124486150-124486172 CAGCAGGGCTGGGCTTCTGTGGG - Intronic
1104771927 12:131369062-131369084 CGGCAGGGCAGGAAGGATCTGGG + Intergenic
1104845293 12:131843923-131843945 CAGAAGGGCTGGTGGGATGTGGG + Intronic
1105441327 13:20417428-20417450 CAGAAGGGCTGGACTCAGGTAGG - Intronic
1106388499 13:29312044-29312066 CAGTGGGGTTGGAGGGATGTGGG - Intronic
1108639733 13:52371830-52371852 CAGCAGGGCAGGGCAGCTGTCGG + Intergenic
1112258700 13:97858234-97858256 CAGCAGGCCTGGAAGGAGGAAGG + Intergenic
1113429990 13:110241322-110241344 CAGCAGGGCTGGAGCCAAGTTGG - Intronic
1113860680 13:113483803-113483825 CAGCAAAGCCGGACGGATGTCGG - Intronic
1113910740 13:113840088-113840110 CAGCAGGCCTGGACGCAAGGTGG + Intronic
1117460799 14:55942926-55942948 GAGCAGGGCTGGAAGGCTGGAGG - Intergenic
1118687535 14:68306046-68306068 CAGAGGGGAGGGACGGATGTGGG - Intronic
1121309850 14:92929824-92929846 CAGCCGGTCTGGCCGGAGGTGGG + Intronic
1122189871 14:100032877-100032899 GAGCAGAGCTGGACACATGTTGG + Intronic
1122277696 14:100603703-100603725 CAGCAGGGCTGGACGAAGGCTGG - Intergenic
1123091968 14:105745938-105745960 CAGCATGGCTGGTGGGAGGTGGG - Intergenic
1123165556 14:106322414-106322436 GAGGAGGGCTGGACTCATGTAGG - Intergenic
1125330391 15:38576062-38576084 CAGCAGGGATGGAAGGTTCTTGG + Intergenic
1125713654 15:41806515-41806537 CAGCAGGCCTGGACCTGTGTAGG + Intronic
1127532012 15:59852595-59852617 CAGCAGGGCTGGAAGGAACATGG + Intergenic
1128600430 15:68991184-68991206 CAGCAGAGCAGGGCGGAGGTTGG - Intronic
1128666349 15:69540818-69540840 CAGCGGGGCTGGGAGGATGTGGG + Intergenic
1128910969 15:71514332-71514354 TAGGAGGGCTTGACAGATGTGGG + Intronic
1130258772 15:82338326-82338348 CAGAAGGGCGGGAGGGATGGCGG - Intergenic
1130269912 15:82440777-82440799 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130462248 15:84168078-84168100 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130473868 15:84247000-84247022 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130481282 15:84361064-84361086 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130490426 15:84426695-84426717 CAGAAGGGCGGGAGGGATGGCGG - Intergenic
1130502016 15:84505465-84505487 CAGAAGGGCGGGAGGGATGGCGG - Intergenic
1130596151 15:85251615-85251637 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1133138400 16:3728171-3728193 CTGCAGGGCTTGCTGGATGTTGG + Exonic
1133539378 16:6734183-6734205 TTGCAGAGCTGCACGGATGTGGG - Intronic
1133739400 16:8640219-8640241 CAGCAGAGCTGGGAGGATGGAGG + Intronic
1135960569 16:26991463-26991485 ATGCTGGGCTGGACAGATGTGGG + Intergenic
1137505510 16:49050866-49050888 CAGTAGGTCTGGAGGGATGTGGG - Intergenic
1138418815 16:56886393-56886415 CACCAGGGCCGGGCGGAAGTTGG - Exonic
1139649813 16:68356582-68356604 CGGCAGGGCAGGAAGGAAGTGGG + Intronic
1139962028 16:70723690-70723712 CAGCAGGGCTGGTAGGGTGATGG - Intronic
1140143604 16:72284425-72284447 CAGCAGATCTGGAAGGATGGAGG - Intergenic
1140519936 16:75572299-75572321 CAGCAGGGCAGGATGGGTGGTGG - Intronic
1141493417 16:84390242-84390264 CAGCGGGGCTGGACTGAGGGAGG + Intronic
1142205830 16:88782747-88782769 CAGCTGGCCTGGCCGGAGGTGGG - Intronic
1143643027 17:8210417-8210439 CCGCAGGGCTGGAAGGAGGTAGG - Intronic
1144807689 17:17978594-17978616 CAGCAGGGCTGGACTGAGGCAGG - Intronic
1144959883 17:19039020-19039042 CACCATGGCTTGACGGATGGAGG + Intronic
1144975277 17:19135504-19135526 CACCATGGCTTGACGGATGGAGG - Intronic
1145352606 17:22098843-22098865 CAGAAGGGCTGGAGGGAATTAGG + Intergenic
1146914608 17:36670616-36670638 GAGCAGGGCAGGACGGAGGGAGG - Intergenic
1147412576 17:40264441-40264463 CAACAGAGCTGGACAGATATTGG - Intronic
1149470238 17:56910454-56910476 CAGCAAGGCCGGATGTATGTAGG - Intronic
1149555926 17:57573579-57573601 CAGCAGGTCTGGAGTGATGGGGG - Intronic
1149974345 17:61251039-61251061 GGGCAGGGCTGGAGGGATGAGGG - Intronic
1151713830 17:75821472-75821494 CTGCAGGGCTGGTCTCATGTGGG + Intronic
1152132284 17:78484753-78484775 CAGTAGGGCAGGACTGGTGTGGG - Intronic
1152541811 17:80980343-80980365 GTGCTGGGCTGGAGGGATGTTGG - Intergenic
1152584056 17:81181360-81181382 CAGCGGGGCTGGACGGGCGGGGG - Intergenic
1152800125 17:82327061-82327083 CAGGAGGGGTGGACTGAGGTTGG - Intronic
1153104563 18:1511641-1511663 CAGCTGGGCTTCAAGGATGTTGG + Intergenic
1154367236 18:13722299-13722321 CAGCAGGGATGGTTGGATCTAGG - Intronic
1156780480 18:40844587-40844609 CAGCATGGCTGGATGGCTCTGGG + Intergenic
1157325274 18:46664482-46664504 CAGCAGAGCTGGGCTGATGGAGG - Intergenic
1157396550 18:47346265-47346287 CAGCAGGGATGGAGGGCTGTTGG + Intergenic
1158890895 18:61870894-61870916 CAGCTGGGCTGAACTGATTTGGG - Intronic
1159851141 18:73528533-73528555 CAGCAGGGCATGAGGAATGTAGG + Intergenic
1159905181 18:74083339-74083361 CAGCAGGGCTCGACGGAAGCAGG + Intronic
1160669175 19:348675-348697 AAGCAGGGCTGGAGGGAGGGAGG - Intergenic
1160752550 19:741354-741376 CAGCTGGGCTGGAGGGCTGAGGG + Intronic
1160844434 19:1160225-1160247 CAGCCGGGCTGCAGGGATGTGGG - Intronic
1161723787 19:5917219-5917241 CAGCAGGGTGGGAAGGGTGTGGG + Exonic
1162566450 19:11447716-11447738 CAGCAGGGCTGGCCGGCTGCGGG - Exonic
1163125401 19:15241669-15241691 AAGCAGGGCTGGACTCCTGTTGG - Intronic
1167122778 19:47528867-47528889 CTGCAGGGCTGGTCGGGGGTCGG - Intronic
1167515190 19:49919253-49919275 GAGCAGGGCTGGGAGGCTGTGGG - Intronic
1167854835 19:52229086-52229108 CATCAGGGCTGGAGGGAAGGAGG + Exonic
1168353132 19:55687708-55687730 CAGCAGGGATTGACGGACTTGGG - Intronic
1168528962 19:57111583-57111605 CAGCATGGCAGAACTGATGTAGG - Intergenic
1202691340 1_KI270712v1_random:97107-97129 GAGCAGGGCTGGACCAACGTTGG + Intergenic
925900441 2:8505512-8505534 CAGCATGGCTGGAGCGATGCGGG - Intergenic
926295287 2:11564609-11564631 CTGAAGAGCTGGAGGGATGTAGG - Intronic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
930001380 2:46863934-46863956 TAGCTGGGCTGGCTGGATGTTGG - Intergenic
930416017 2:51092530-51092552 CAGCAGGCCTGGACCCAAGTTGG + Intergenic
934273945 2:91563641-91563663 GAGCAGGGCTGGACCAACGTTGG + Intergenic
934323359 2:91985605-91985627 GAGCAGGGCTGGGCCAATGTAGG - Intergenic
934943102 2:98516513-98516535 CCCCAGGGCTGGCAGGATGTTGG + Intronic
935191538 2:100782361-100782383 CAACAGGTCTGGATGGCTGTGGG - Intergenic
935266767 2:101401671-101401693 AAGCAGAGCTGGACTGATGGAGG - Intronic
936595666 2:113845032-113845054 GAGCTGGGCTGGTCTGATGTGGG - Intergenic
938915522 2:135935145-135935167 CAGCAGAGCTGGACTGAATTTGG - Intronic
941015096 2:160346561-160346583 CAGGAGGAGTGGACGGATGATGG - Intronic
942705003 2:178761250-178761272 AAGAAGGGATGGACAGATGTGGG - Intronic
947084991 2:226441207-226441229 CAGCAGTGATGGACTGATCTGGG + Intergenic
948458949 2:238119954-238119976 CAGCACGGCAGGACTGGTGTGGG - Intronic
948973566 2:241448192-241448214 GAGCAGGGCTGGCATGATGTAGG - Intronic
1170161262 20:13313524-13313546 CAGCAGGGCTGGAGTGTTGCTGG + Intergenic
1172936252 20:38622680-38622702 CTGCAGGCATGGAGGGATGTGGG - Intronic
1173251069 20:41364562-41364584 CAGCAGGGCTGCACGCACATGGG - Intronic
1175123656 20:56735882-56735904 CAGCAGGGATGAAGGGATGGTGG - Intergenic
1175940600 20:62535923-62535945 CAGCAGGGCTGGACACAAATGGG + Intergenic
1177774347 21:25551272-25551294 CAGTAGAGATGGACAGATGTAGG + Intergenic
1180151561 21:45950801-45950823 CAACAGGGCTGGAGGGAGGGAGG - Intergenic
1180550102 22:16531476-16531498 GAGCAGGGCTGGGCCAATGTTGG - Intergenic
1181021145 22:20103698-20103720 CAGAAGGGCAGGACAGATATAGG + Intronic
1181354571 22:22290345-22290367 GAGCAGGGCTGGGCCAATGTTGG + Intergenic
1182049168 22:27299915-27299937 AAGCAGGGCCAGACGGATGCTGG + Intergenic
1182989182 22:34750714-34750736 CAGCAGGGTTGGAGGAAAGTGGG + Intergenic
1183418724 22:37697691-37697713 CAGCAGGTGAGGATGGATGTGGG + Exonic
1184228999 22:43148224-43148246 CAGCATGGCAGTAGGGATGTTGG - Intergenic
1185040763 22:48502997-48503019 CTGCAGAGGTGGAAGGATGTGGG + Intronic
1185107567 22:48882965-48882987 CAGAAGGGATGGATGGATGAGGG - Intergenic
951498952 3:23362488-23362510 CAGCAGGGATGGAGGGAGGAGGG - Intronic
952003254 3:28810294-28810316 GAGCAGGGCTGGAGGGAACTGGG + Intergenic
952900977 3:38111679-38111701 TAGCAGGGCAGGAGGCATGTTGG - Exonic
956606139 3:71074809-71074831 CAACTGGGCTGGCTGGATGTGGG + Intronic
959619975 3:108389509-108389531 AAGCAGGACTGGAGGGTTGTGGG - Intronic
963159984 3:142141141-142141163 GAGCAAGGCTCCACGGATGTGGG + Intronic
964090310 3:152868540-152868562 CAGAAGGGCTGGAGGGATGTGGG - Intergenic
967494761 3:190130273-190130295 CAGCAGGACTGGACTGGTGTAGG - Intergenic
968713752 4:2139250-2139272 AAGCAGGGCTGGCCGGAGCTTGG + Intronic
968927907 4:3559621-3559643 GATCAGGACTGGAAGGATGTGGG + Intergenic
969445751 4:7243905-7243927 CAGCAGGCCTGGCCCGATGGTGG + Intronic
969459887 4:7323525-7323547 CAGGAGGGCTGGGAGGATGTGGG + Intronic
973330414 4:48906373-48906395 CTGCAGGGCTGGACGGCGGACGG + Intronic
975497791 4:75053848-75053870 GAGGAGGGCTGGAAGGATGGGGG - Intergenic
976330083 4:83821590-83821612 CAGCAGGGATGGCAGGATATGGG + Intergenic
976526636 4:86099507-86099529 CAGCAGGGCATGCCTGATGTGGG + Intronic
980563878 4:134512062-134512084 CAGAAGGGCTTGATGGGTGTAGG - Intergenic
981847122 4:149182218-149182240 CAGCATGGGTGGAAGGGTGTAGG + Intergenic
983997557 4:174204287-174204309 CAGCAGGCCTGGGAGGATGAAGG - Intergenic
984936995 4:184898219-184898241 CAGCAGGACAGGAAGGCTGTGGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985307151 4:188555578-188555600 CAGCAGAGCAGGACGGACGGAGG + Intergenic
985408144 4:189656486-189656508 CAGGAGGCCTGGACGGAGCTTGG - Intergenic
985950490 5:3218593-3218615 CTGCAGGGCTCCACGGATGCAGG + Intergenic
986144713 5:5066461-5066483 CAGCAGGGCTGGGAGGAAATTGG + Intergenic
986483438 5:8212210-8212232 AGGAAGGGCTGGACGGATGGCGG + Intergenic
987878664 5:23712337-23712359 CTGCAGGGCTGGGCGGGTGGGGG - Intergenic
988783254 5:34542727-34542749 CAGCAGTGCTGTACGAAGGTAGG + Intergenic
989209783 5:38846961-38846983 CAGGATGGATGGACGGATGCAGG - Intronic
991625148 5:68593558-68593580 CAGCAGGGCAGCACGGAGGAAGG + Intergenic
993658230 5:90598562-90598584 TAGCAGGCCTGGACAGATGGAGG + Intronic
1001639639 5:173235519-173235541 GGGCAGGGCTGGATGGGTGTGGG + Intergenic
1001957792 5:175860162-175860184 TAGCAGGGCTGGCAGAATGTGGG - Intronic
1002401811 5:178995177-178995199 CGGCAGGGCTGGAGGGGTGGAGG - Intronic
1003644339 6:7902306-7902328 CAGCAGGGCAGGACTGACGGGGG - Intronic
1005149488 6:22732609-22732631 CAGCAGGGGTGGATGGGTGCCGG + Intergenic
1007581704 6:42963811-42963833 CAGCTGGGGTGCAGGGATGTGGG + Exonic
1007687398 6:43675079-43675101 CAGCAGGGGTGGACTGATGGGGG + Intronic
1007735554 6:43980219-43980241 CAGCAGGGCTGGGCGCAGGGAGG - Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1009566204 6:65313991-65314013 CAGCAAGGCTGGAGGGGAGTGGG - Intronic
1012690138 6:102300088-102300110 CAGTAGGGCTTCAGGGATGTGGG - Intergenic
1013172149 6:107646439-107646461 CAGCAGGGAAGGGCAGATGTGGG + Intronic
1016922199 6:149306799-149306821 CAGCAGGGCAGGAAAGTTGTGGG + Intronic
1019928634 7:4209166-4209188 CATCTGAGCTGGAAGGATGTGGG + Intronic
1019974455 7:4569483-4569505 AAGGAGTGCTGGAGGGATGTGGG - Intergenic
1021948518 7:25752223-25752245 CTGCAGGGCTGGGGGGAAGTAGG + Intergenic
1022941854 7:35249369-35249391 CTGCAGGGCTGCAGGGAGGTTGG - Intronic
1023056926 7:36298268-36298290 CAACAGGGCTGGAAGGAAGTTGG + Intronic
1023981647 7:45073986-45074008 CAGCAGGGCAGGGTGGAAGTTGG - Intronic
1025267898 7:57481268-57481290 CAGCAGGTGTGCACGGAAGTGGG - Intergenic
1027723126 7:81769939-81769961 CAGCAGGGCTGGCAGGAGTTTGG + Exonic
1029564892 7:101330113-101330135 GAGCAGAGCTGGGCGGATTTTGG + Intergenic
1031168328 7:118258818-118258840 GTGCAGGGCAGGAAGGATGTAGG + Intergenic
1031752932 7:125600174-125600196 CAGCAGGGATGGAAGTATGGAGG + Intergenic
1033413813 7:141145140-141145162 CACCAGGCCTGGTAGGATGTAGG - Intronic
1034033192 7:147790228-147790250 GAGCAGGGCTGGAGGGGTGCTGG - Intronic
1034313485 7:150110415-150110437 CAGCAAGGCTGGAAGCAGGTGGG + Intergenic
1034536591 7:151729365-151729387 CACCAGGGCTGGACGGTTTTGGG + Intronic
1034672537 7:152869406-152869428 CAGCAGGACTGGGCAGATCTGGG - Intergenic
1034793375 7:153990249-153990271 CAGCAAGGCTGGAAGCAGGTGGG - Intronic
1038347840 8:26748344-26748366 CAGCAGGGCTGGACGGATGTTGG - Exonic
1039493928 8:37966801-37966823 CGGCAGGGGTGGACAGATGGTGG - Exonic
1045727802 8:105195989-105196011 CAGCAGGGTCTGAAGGATGTGGG - Intronic
1046806834 8:118487830-118487852 CAGCATGGCTGGACAAATGATGG + Intronic
1048842973 8:138581285-138581307 CAGCAGGGGTGGAGTGAGGTGGG - Intergenic
1049120905 8:140736371-140736393 CAGCAGGGAGGGAAGGAGGTGGG + Intronic
1049278810 8:141733564-141733586 CAGCATGGCTGGGCTGATGTGGG - Intergenic
1051410161 9:16781246-16781268 GATCAGGGCTGGACTGATATTGG + Intronic
1053802765 9:41774702-41774724 GATCAGGACTGGAAGGATGTGGG + Intergenic
1054142479 9:61540368-61540390 GATCAGGACTGGAAGGATGTGGG - Intergenic
1054191068 9:61986048-61986070 GATCAGGACTGGAAGGATGTGGG + Intergenic
1054462223 9:65471518-65471540 GATCAGGACTGGAAGGATGTGGG - Intergenic
1054647300 9:67601669-67601691 GATCAGGACTGGAAGGATGTGGG - Intergenic
1054927913 9:70606578-70606600 CAGCAAGGCTGCATGAATGTTGG - Intronic
1057124253 9:92603711-92603733 CATCAGGGCTTGCTGGATGTGGG - Intronic
1057302294 9:93893958-93893980 CAGCAGAGCGGGAGGGAGGTGGG - Intergenic
1057702991 9:97376986-97377008 GAGCAGGGGTGGAGGGATGAAGG - Intronic
1059311342 9:113390767-113390789 CAGCAGGGCTGGTGGGAGGGAGG + Intronic
1059949212 9:119444474-119444496 AACCAGGGCTGGAGGGATGAGGG + Intergenic
1060987522 9:127828342-127828364 CAGCAGGGCACGACGTCTGTTGG + Intronic
1061036756 9:128118551-128118573 GAGCAGGGATGGAGGGATGCTGG + Intergenic
1061233214 9:129326940-129326962 CAGCAGGGCTGGGTGGGAGTGGG + Intergenic
1061490832 9:130943359-130943381 CAGCAGGGCTTAGCGGACGTGGG + Intergenic
1061826412 9:133260978-133261000 GAGCAGGGCTGGCAGGATTTGGG + Intronic
1061870276 9:133516729-133516751 CTGCAGGGCTGGCCAGAGGTGGG - Intronic
1062096963 9:134708489-134708511 CAGCAGGGCTGGGTAGATGCGGG - Intronic
1062480240 9:136747720-136747742 CTGCAGGGCTGGAAGGCTGGAGG - Intronic
1185761502 X:2692349-2692371 TATCAGGGCTGGACGTATTTAGG + Intronic
1189776010 X:44470633-44470655 CTGCAGGGGTGGACGGGGGTTGG + Intergenic
1192333475 X:70199160-70199182 GAGCAGGGCTAGGCTGATGTGGG - Intronic
1192682674 X:73268014-73268036 CAGCAGGGCTGCCTGAATGTTGG - Intergenic
1192831275 X:74753258-74753280 CCACAGGGCTGGAAGGATCTTGG + Intronic
1195146756 X:102026262-102026284 CAGCAGGGCTTCAGGGATGTGGG - Intergenic
1196306900 X:114113591-114113613 CAGTAGGGCAGGCCAGATGTGGG + Intergenic
1201190770 Y:11440593-11440615 GAGCAGGGCTGGGCCAATGTAGG - Intergenic