ID: 1038348043

View in Genome Browser
Species Human (GRCh38)
Location 8:26750158-26750180
Sequence CTCAGATAGCAGAAGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038348038_1038348043 -5 Left 1038348038 8:26750140-26750162 CCGTCTCCTCGCTGGAACCTCAG 0: 1
1: 0
2: 1
3: 25
4: 271
Right 1038348043 8:26750158-26750180 CTCAGATAGCAGAAGGGACAAGG No data
1038348035_1038348043 18 Left 1038348035 8:26750117-26750139 CCTGTTTTCTGGTTCATAGGTGG 0: 2
1: 12
2: 88
3: 338
4: 811
Right 1038348043 8:26750158-26750180 CTCAGATAGCAGAAGGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038348043 Original CRISPR CTCAGATAGCAGAAGGGACA AGG Intronic
No off target data available for this crispr