ID: 1038350063

View in Genome Browser
Species Human (GRCh38)
Location 8:26768002-26768024
Sequence TCTGGCACTGAGATGTTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 249}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038350063_1038350068 14 Left 1038350063 8:26768002-26768024 CCGGCCAACATCTCAGTGCCAGA 0: 1
1: 0
2: 1
3: 12
4: 249
Right 1038350068 8:26768039-26768061 CACAAGGCTGAATATGTATCTGG No data
1038350063_1038350066 -2 Left 1038350063 8:26768002-26768024 CCGGCCAACATCTCAGTGCCAGA 0: 1
1: 0
2: 1
3: 12
4: 249
Right 1038350066 8:26768023-26768045 GAATCCAAGTTCTGAACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038350063 Original CRISPR TCTGGCACTGAGATGTTGGC CGG (reversed) Intronic
900341242 1:2190358-2190380 GCTGGCGCTGGGATGGTGGCCGG + Intronic
901439497 1:9269062-9269084 TCTGACACTGAGATGCTGCCAGG - Exonic
903278972 1:22239364-22239386 TCTGGGACTGGGCTGGTGGCCGG - Intergenic
903644961 1:24889767-24889789 TCTGAAACCAAGATGTTGGCAGG + Intergenic
904248917 1:29208532-29208554 TCTGGAACTGGAATGTGGGCTGG - Intronic
905234194 1:36534574-36534596 TCTGGCACCTCGATGTTGGTAGG + Intergenic
905478285 1:38244229-38244251 GCTGGCTGTGAGATGTTGGTCGG + Intergenic
907923816 1:58937353-58937375 TCTGGAACTGATGTGTGGGCAGG + Intergenic
909701074 1:78523947-78523969 TCTAGTACTGAGATATTTGCTGG - Intronic
911648012 1:100356134-100356156 TGTGAAATTGAGATGTTGGCTGG + Intronic
912409495 1:109470410-109470432 TTTGGCACTGACATGCTCGCTGG - Intronic
913111993 1:115665249-115665271 GCTTGCACTGAGATGTTCTCTGG + Intronic
913461727 1:119093669-119093691 TCTGACACTGAGGTGTTGGCAGG - Intronic
915148826 1:153812507-153812529 GCTGGCTCTAAGAAGTTGGCTGG + Intronic
916442155 1:164838060-164838082 TGTGGCATTAGGATGTTGGCAGG + Intronic
917028910 1:170668639-170668661 TCTGGCGAAGAGAAGTTGGCGGG - Intronic
917540333 1:175906474-175906496 TCTGGCACTGCCATGTGGTCAGG + Intergenic
917861286 1:179147030-179147052 TCTGGCTCTGTCATGTGGGCTGG - Intronic
921152073 1:212410801-212410823 TCTGAAATTGAGGTGTTGGCAGG + Intronic
921371359 1:214426230-214426252 TTGGGCAGTGAGATGTTTGCTGG - Intronic
922085953 1:222347065-222347087 CCAGGCACTGAGATTTTGCCAGG + Intergenic
922110760 1:222552985-222553007 TCTGAGATTAAGATGTTGGCAGG + Intergenic
922386627 1:225091689-225091711 TCTGTCATTGTGTTGTTGGCCGG - Intronic
922618265 1:226976101-226976123 TGTGGGACTGCGATGTTGCCTGG + Intronic
922618277 1:226976149-226976171 TGTGGGACTGCGATGTTGCCTGG + Intronic
922618289 1:226976197-226976219 TGTGGGACTGCGATGTTGCCTGG + Intronic
922618301 1:226976245-226976267 TGTGGGACTGCGATGTTGCCTGG + Intronic
922618316 1:226976301-226976323 TGTGGGACTGCGATGTTGCCGGG + Intronic
922618328 1:226976349-226976371 TGTGGGACTGCGATGTTGCCTGG + Intronic
922618340 1:226976397-226976419 TGTGGGACTGCGATGTTGCCTGG + Intronic
922841653 1:228647520-228647542 TCTGGAGCGGAGATCTTGGCTGG + Intergenic
923388536 1:233490407-233490429 TATGGCCCTGAGCTGCTGGCTGG + Intergenic
924455761 1:244217778-244217800 TCTGGAGCTTAGATGTGGGCTGG + Intergenic
1062830397 10:601715-601737 GCTGGCCCTGAGATGCTGGCAGG - Intronic
1063344356 10:5297450-5297472 TCTGAAATTGAGGTGTTGGCAGG - Intergenic
1065195848 10:23264816-23264838 TGAGGCTCTGAGATGATGGCTGG - Intergenic
1066522578 10:36238703-36238725 CCTGCCACTGAGATGTGTGCTGG - Intergenic
1067156356 10:43784223-43784245 TCTGTCAATGAGCTGATGGCTGG + Intergenic
1068285437 10:54927969-54927991 TCTGTCACTGTGATATTAGCTGG + Intronic
1071525733 10:86357135-86357157 TCTGGACCTGAGGTGTGGGCAGG - Intronic
1072724474 10:97803493-97803515 TCTGGCCCTCAGATGAAGGCAGG + Intergenic
1073507053 10:104004970-104004992 TCTGGCCCTGAGATGGAGGGAGG + Intronic
1073882806 10:108003222-108003244 TATGCCACTGAGAAGTTGGAAGG + Intergenic
1074110887 10:110422087-110422109 TCTGGGACTGGGATGGGGGCTGG + Intergenic
1074930791 10:118123713-118123735 TCTGAAATTCAGATGTTGGCTGG - Intergenic
1077132636 11:980943-980965 TCTGGCTCTTCGATGCTGGCAGG + Intronic
1077828573 11:5837779-5837801 TCTGTCACTGTGTTGTTAGCTGG + Intronic
1078187154 11:9061765-9061787 TCTGGAAGTGACATGTTAGCAGG + Intronic
1079023926 11:16930894-16930916 TCTGTCCCTGAGCTGTTGCCTGG - Intronic
1079293356 11:19209143-19209165 TCTTGCACTGAGAGATTAGCAGG + Intronic
1079426081 11:20343141-20343163 TCTGTCCCTGAGATCCTGGCTGG - Intergenic
1079737662 11:24017165-24017187 TCTGGCTTTGAGATGTAGGAAGG + Intergenic
1080601219 11:33821957-33821979 TCTGGACCTGAGATGAAGGCAGG - Intergenic
1081191588 11:40109690-40109712 TCTGGCAATGAGATAAAGGCAGG + Intergenic
1081194929 11:40149992-40150014 TCTGAAACTGAGATGCTGCCAGG + Intronic
1082623117 11:55448653-55448675 GCTGGCAGAGGGATGTTGGCTGG + Intergenic
1082625675 11:55481848-55481870 GCTGGCAGAGGGATGTTGGCTGG + Intergenic
1083651459 11:64207036-64207058 TCTGGGAGTGAGCTGTGGGCTGG + Intronic
1083816533 11:65135387-65135409 TCAGACACTGAGATGCGGGCAGG - Intergenic
1084613944 11:70222495-70222517 TCTGTCACTGTGTTGTTAGCTGG - Intergenic
1085024712 11:73229711-73229733 TCTGACACTGAGATGAGGGGTGG - Intronic
1086971390 11:93084764-93084786 TATGGCACTAAAATGTTGGAAGG + Intergenic
1088698541 11:112391169-112391191 TCTGGAACTCAGGTGTGGGCAGG + Intergenic
1088790979 11:113226040-113226062 CCTGTCATTGAGATGTTAGCTGG - Intronic
1088967338 11:114736986-114737008 GCTAGCACTCAGAGGTTGGCAGG - Intergenic
1089601016 11:119615136-119615158 CCTGGCACTGTGCTGATGGCTGG + Intergenic
1090050797 11:123377239-123377261 CCTGGCACTGAGATGGTAGCTGG + Intergenic
1091057164 11:132430021-132430043 TCTGGCACTGAGACGAGGTCGGG + Intronic
1091469372 12:713530-713552 CCTGGCAGTGAGATGTTCCCTGG + Intergenic
1096114025 12:49044674-49044696 TCTGGGAGTGGGATGTTGGGTGG - Intronic
1096952307 12:55485980-55486002 TCTGTCATTGTGATGTTAGCTGG - Intergenic
1096995094 12:55833375-55833397 GCTGGCACTGGGGAGTTGGCTGG + Intergenic
1097611280 12:61824255-61824277 TCTGCAACTCACATGTTGGCTGG - Intronic
1098188538 12:67923960-67923982 TCCAGCACTGAGATGATGCCAGG + Intergenic
1098903374 12:76135682-76135704 GGTTGCACTTAGATGTTGGCTGG - Intergenic
1101325086 12:103708492-103708514 CCTGTGACTGTGATGTTGGCTGG + Exonic
1101397475 12:104361117-104361139 TCTGGCAGAGAGATGTTCACTGG - Intergenic
1101407942 12:104445427-104445449 TCTGAAATTGAGATGTTGGCAGG - Intergenic
1101515260 12:105429212-105429234 TTTGGCACTGAGATATAGGATGG + Intergenic
1102439464 12:112950142-112950164 TCTGGAACTTACATGCTGGCTGG - Intronic
1103922073 12:124404295-124404317 TCTGGCCCTGGGCTGTTGCCAGG - Intronic
1106337426 13:28796419-28796441 TCACGCACAGAGATGCTGGCAGG - Intergenic
1115475277 14:33807527-33807549 TCTGCCAGTGACATGGTGGCAGG + Intergenic
1117064275 14:51994349-51994371 TCTTGCATTTAGATGTTGGCAGG - Intronic
1117455451 14:55892633-55892655 TCTGTAACTCAGATGTTAGCTGG - Intergenic
1118861001 14:69663462-69663484 TGTAGCAGAGAGATGTTGGCAGG + Intronic
1119113182 14:71994808-71994830 TCTGGGACCTAGGTGTTGGCAGG - Intronic
1119884055 14:78125479-78125501 TCTGGAACTGAGATGATGCTGGG - Intergenic
1120850270 14:89163307-89163329 TCTGACTCTGTGGTGTTGGCGGG - Intronic
1121380815 14:93464285-93464307 TCTGAGATTGAGGTGTTGGCAGG + Intronic
1121623828 14:95370225-95370247 TCTGGGGCTGAGATGGTGGAGGG + Intergenic
1122514978 14:102301134-102301156 TCATGCACTCAGATGGTGGCTGG - Intronic
1122794422 14:104198871-104198893 TCTGGCTCTGACATCTTTGCCGG + Intergenic
1124596642 15:31096877-31096899 TCAGGGACTGTGATGTTTGCTGG + Intronic
1124606102 15:31171378-31171400 TCTGAGACTGAGGTGTGGGCAGG + Intergenic
1124863574 15:33467422-33467444 GCTGGCTCTGAGCTGATGGCTGG - Intronic
1127310349 15:57746693-57746715 TCTGGCTCTGAGAAATGGGCAGG - Intronic
1128944766 15:71812714-71812736 TCTGGCACAGGGATGATGGTCGG + Intronic
1130944904 15:88543655-88543677 TTTTGCACTGAGGTGTTTGCTGG - Intronic
1131278186 15:90999852-90999874 GCTGGCAGTGAGAGGTGGGCTGG - Intronic
1131389427 15:92034789-92034811 ACTGTCATTGAGACGTTGGCTGG + Intronic
1132654522 16:1036334-1036356 CCTGGCACTGAGACCTTGCCTGG + Intergenic
1134306888 16:13041125-13041147 TCCAGCTCTGAGATGTTGGGAGG - Intronic
1134760032 16:16706095-16706117 CCTGGCTCTGAAATGTTTGCAGG - Intergenic
1134986039 16:18653110-18653132 CCTGGCTCTGAAATGTTTGCAGG + Intergenic
1135591269 16:23706551-23706573 TCTGCCACTGTGATGTTCACAGG - Intronic
1136709285 16:32222000-32222022 TCTGAAACTAAGATGTTGGTGGG + Intergenic
1136758625 16:32707419-32707441 TCTGAAACTAAGATGTTGGTGGG - Intergenic
1136809483 16:33162960-33162982 TCTGAAACTAAGATGTTGGTGGG + Intergenic
1136815959 16:33273040-33273062 TCTGAAACTAAGATGTTGGTGGG + Intronic
1138688096 16:58743964-58743986 TCTGGCTCTGTGATCCTGGCTGG + Intergenic
1141570892 16:84933037-84933059 CCTGGCACTGAGGGGTTGTCTGG - Intergenic
1203060779 16_KI270728v1_random:967747-967769 TCTGAAACTAAGATGTTGGTGGG - Intergenic
1148886215 17:50774876-50774898 TCTGGCACTGTCATCTAGGCTGG + Intergenic
1149290184 17:55210452-55210474 TCCTGCTCTGTGATGTTGGCAGG + Intergenic
1150622848 17:66821523-66821545 TCGGTCACTGACAAGTTGGCTGG + Intergenic
1152556803 17:81057327-81057349 TCTGCCTCTGAGATGCTGGGAGG + Intronic
1153017732 18:598636-598658 TGTGGCACTGAGTTCTTGGATGG + Intronic
1155162025 18:23203903-23203925 TCTGCCACTGAGGGGATGGCAGG - Intronic
1155432158 18:25770938-25770960 TCTGAGACTGAGATGTTAGGAGG + Intergenic
1156625484 18:38902626-38902648 TCTGGAACTGTGATGATGGAGGG - Intergenic
1158023716 18:52871275-52871297 TATGTCACTGAGAGGTTGACTGG - Intronic
1158669922 18:59465212-59465234 GCTGGCACTGACAACTTGGCAGG + Intronic
1160613727 18:80108864-80108886 ATTGGCTCTGAGATGTGGGCGGG + Intergenic
1162072304 19:8161319-8161341 TCTTGCACTGAGGTGATGCCGGG + Intronic
1165721663 19:38083194-38083216 TCTGGCACTGAGGATGTGGCGGG + Intronic
1166153626 19:40893822-40893844 CCTGAGACTGAGATCTTGGCAGG + Exonic
1166174770 19:41059438-41059460 CCTGAGACTGAGATCTTGGCAGG - Intergenic
1167189067 19:47970756-47970778 TGTGGCAATGGGATGTTAGCAGG + Intronic
925223120 2:2159060-2159082 TGTGGAAGTGAGATGTGGGCAGG - Intronic
926172221 2:10559479-10559501 ACTGGGCCAGAGATGTTGGCGGG - Intergenic
926530724 2:14041213-14041235 TCCGTCACTGAAATGTTTGCTGG + Intergenic
926924974 2:17978082-17978104 TCTGGAACTGAGATTTAGGAAGG - Intronic
928193621 2:29196549-29196571 TCTGGCACTGTGCTGTGTGCTGG + Intronic
929523760 2:42680329-42680351 GCTGGCACTGAGACCTTGACTGG + Intronic
933836814 2:86252454-86252476 TCTGGCAGTCAGTTGGTGGCAGG - Intronic
935002480 2:99032982-99033004 TCTGCAACTGTGATGTTGGTTGG - Intronic
935200654 2:100853778-100853800 TCTGGCACACATCTGTTGGCTGG + Intronic
937087212 2:119179342-119179364 TCTGGCACAGACAGGTTGGCAGG + Intergenic
937271495 2:120655680-120655702 TCCAGGTCTGAGATGTTGGCAGG - Intergenic
937597527 2:123688819-123688841 TATTGCACTGAGGTGTTTGCTGG - Intergenic
938062503 2:128264149-128264171 TTTGTCACTGGGATGGTGGCAGG + Intronic
938062517 2:128264209-128264231 TTTGTCACTGGGATGGTGGCAGG + Intronic
938081463 2:128372539-128372561 TCTGGAGCTGTGAGGTTGGCAGG + Intergenic
938576470 2:132608937-132608959 TTTGGCCTTGTGATGTTGGCAGG - Intronic
939042140 2:137202555-137202577 TCTGACAGTTAGGTGTTGGCAGG - Intronic
940640430 2:156340498-156340520 GCTGTCACTGACATGTTGGGAGG + Intronic
942571849 2:177323034-177323056 ACTGGCACTTAGATCTGGGCAGG - Intronic
944414377 2:199468175-199468197 GCTGTCACTGAGAGCTTGGCAGG + Intronic
945072983 2:206009595-206009617 ACTGGCAGTGAGACGCTGGCGGG + Exonic
945493149 2:210479149-210479171 TCTGGGATTAAGATGTTAGCAGG + Intronic
945584696 2:211645026-211645048 TCTGGCACTGAGTTAGTTGCTGG + Intronic
946064003 2:216970548-216970570 TCTTGCAGTCAGATATTGGCTGG + Intergenic
946307593 2:218865058-218865080 TCTGGCACTGAGACATTTCCTGG + Intronic
946870639 2:224081443-224081465 TCTGGCATTAAGATGTTTGCTGG + Intergenic
946968338 2:225064598-225064620 GCTGAAACTGAGGTGTTGGCAGG + Intergenic
1169571682 20:6913188-6913210 TCTGGCACTGAGAGGTGGGGGGG + Intergenic
1171338848 20:24411411-24411433 TCTGGCACAGAGTTGCAGGCTGG - Intergenic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1171456915 20:25277370-25277392 TCTGGCATAGAGAGGTGGGCTGG + Intronic
1173921509 20:46749721-46749743 TCAGGTACTGACATGTGGGCTGG - Intergenic
1174485229 20:50856743-50856765 TCAGGCACAAAGATGCTGGCAGG - Intronic
1174696610 20:52565765-52565787 TCTGGAACTCAGTTGTAGGCAGG - Intergenic
1175724850 20:61310714-61310736 TCTGGGATGGAGGTGTTGGCAGG + Intronic
1177685806 21:24435760-24435782 TCTGCTTCTGAGATGTTGGGAGG - Intergenic
1180964106 22:19776727-19776749 GCTGGCTCTGAGTTGGTGGCTGG - Intronic
1181487339 22:23239709-23239731 TATGAGATTGAGATGTTGGCTGG + Intronic
1181790029 22:25257906-25257928 TCCAGCAGTGAGATGATGGCAGG - Intergenic
1181824824 22:25506595-25506617 TCCAGCAGTGAGATGATGGCAGG - Intergenic
950125535 3:10507566-10507588 CCTGGCACAGACATGTAGGCTGG - Intronic
950211182 3:11124707-11124729 TCTGGTACTGAACTGATGGCGGG + Intergenic
950734319 3:14993026-14993048 TTAGGCACTGAGGTGTGGGCAGG + Intronic
955060632 3:55489027-55489049 CCTGCCACGGAGATCTTGGCGGG + Intronic
955947791 3:64211920-64211942 GCTGTCACTGAGATGTTGACAGG + Intronic
956309576 3:67864135-67864157 ACTGCCACTGAGAAGTGGGCAGG + Intergenic
959565278 3:107826748-107826770 TCAGGCACTGATTTGGTGGCAGG - Intergenic
959989156 3:112611643-112611665 TCAGACACTGATATTTTGGCTGG + Intronic
961466202 3:127083131-127083153 TCTGGTGCTGTGATGTGGGCAGG - Intergenic
961653540 3:128429243-128429265 TCTGGCTGTGAGATGAGGGCAGG - Intergenic
962280753 3:134049968-134049990 TCTGCCTCTGAGTTGTTGGTTGG - Intronic
962944567 3:140155230-140155252 TCTGGGAATGGAATGTTGGCAGG + Intronic
965304953 3:167052462-167052484 TCTGGTGCTGAGCTGCTGGCAGG + Intergenic
968228335 3:196989839-196989861 TCTGACACTAAGATGTCAGCAGG - Intronic
969205087 4:5637776-5637798 TCTGCCACTGAGTTGTGGGATGG + Intronic
970261336 4:14227955-14227977 CATGGCAATGAGATGCTGGCAGG + Intergenic
970590585 4:17556700-17556722 TCTCTCACTTTGATGTTGGCAGG - Intergenic
971707045 4:30058401-30058423 TCTGGCACTGGTAGCTTGGCAGG + Intergenic
976544357 4:86317377-86317399 TCTGGCCCTCAGAGGTGGGCAGG - Intronic
976951984 4:90844775-90844797 TCTGTCACTTACATATTGGCTGG - Intronic
978690002 4:111496845-111496867 TCTGAGATTGAGATGTTGTCAGG + Intergenic
981429111 4:144640371-144640393 TCTGAAATTAAGATGTTGGCAGG - Intergenic
986422849 5:7601427-7601449 TCTGGCACTAAGATTTAGGTAGG + Intronic
987424038 5:17753638-17753660 TCTGGCATTATGATGTTAGCTGG + Intergenic
989412761 5:41139567-41139589 TCTGAAACCAAGATGTTGGCAGG - Intergenic
992190693 5:74288777-74288799 TCTGGCATTGAGATGTTAAAAGG - Intergenic
993075035 5:83219002-83219024 CCTGAAATTGAGATGTTGGCAGG + Intronic
995216483 5:109601004-109601026 CCTGGCTATGTGATGTTGGCAGG + Intergenic
995487462 5:112653620-112653642 TCTAGCTATGAGATGATGGCTGG - Intergenic
995860952 5:116639886-116639908 GCTTGCTCTGAGATGTTGGTAGG - Intergenic
996569136 5:124913209-124913231 ACAGGCACTGGCATGTTGGCAGG - Intergenic
998449082 5:142220603-142220625 TCTGTCCCTTAGATGCTGGCTGG - Intergenic
998857472 5:146407215-146407237 TCTGGCTCAGAACTGTTGGCAGG + Intergenic
1002423824 5:179164386-179164408 TGTGGCACTGAGATGCATGCAGG + Intronic
1006521267 6:34572604-34572626 CCTGGGACTGAGGTGTGGGCAGG + Intergenic
1006719317 6:36139777-36139799 TCTGGGATGGAGGTGTTGGCAGG + Exonic
1008584699 6:52938040-52938062 TCTGGCACTGACCGGCTGGCTGG + Intergenic
1009744912 6:67799494-67799516 TCAGGCCCAGAGATGTTGTCTGG - Intergenic
1012882974 6:104813714-104813736 TGAGGCACTCAAATGTTGGCTGG - Intronic
1017213640 6:151883750-151883772 TCTGAGACTAAGGTGTTGGCAGG + Intronic
1017638565 6:156467428-156467450 TCTGAAATCGAGATGTTGGCAGG - Intergenic
1017694352 6:156999712-156999734 GCTGGCACTGAGAGGCAGGCAGG - Intronic
1017778753 6:157700032-157700054 TCTGGCCCTGAGATAAGGGCAGG + Intergenic
1019701305 7:2476107-2476129 TCTGGCACTGGGTTGGGGGCAGG - Intronic
1020460212 7:8421844-8421866 TTTGGACATGAGATGTTGGCGGG - Intergenic
1022204405 7:28149549-28149571 TCTGACACTGAGAAGTTCACCGG - Intronic
1024950934 7:54859674-54859696 TGCTGCACTGAGCTGTTGGCTGG + Intergenic
1026996044 7:74617371-74617393 TGGGGCTCTGAGATGGTGGCTGG + Intergenic
1027532541 7:79353948-79353970 TCTGGCACTGGGCAGTTGGCTGG + Intronic
1029358808 7:100073075-100073097 TCTAGCAGAGAGATGGTGGCAGG + Intronic
1029399923 7:100337581-100337603 TCGGGCCCTGGGATGTTGGTGGG - Intronic
1029512517 7:101005075-101005097 CCTGGCACTGTGGTGCTGGCAGG - Exonic
1031427496 7:121623822-121623844 TTTGCCCCTGAGATGTGGGCAGG - Intergenic
1032397088 7:131598321-131598343 TCTGAAACTGAGGTGTTGGCAGG + Intergenic
1033946467 7:146724985-146725007 TCTGCAACCCAGATGTTGGCAGG + Intronic
1034852935 7:154513282-154513304 TCTGGGACTGTGAGGTTGGTGGG - Intronic
1037240682 8:16773760-16773782 TCTGGCACTGAAAGGTTGTGTGG + Intergenic
1038350063 8:26768002-26768024 TCTGGCACTGAGATGTTGGCCGG - Intronic
1040372003 8:46786312-46786334 TCTGTCACTGTGATCTTAGCTGG + Intergenic
1041187493 8:55315983-55316005 TCTGGGACTTAGATCTTAGCTGG + Intronic
1043565614 8:81544289-81544311 TCTGAAAACGAGATGTTGGCAGG + Intergenic
1044104772 8:88190248-88190270 TCTGGCACAGAGATATTAGTGGG + Intronic
1045658728 8:104413847-104413869 TCTGGGACTCACATGTTTGCAGG + Intronic
1045776556 8:105810283-105810305 TCTGACATCAAGATGTTGGCAGG + Intergenic
1046738942 8:117808634-117808656 CCTGGCACTGTGATGGTAGCTGG + Intronic
1047152835 8:122284152-122284174 TCTGAAATTGAGGTGTTGGCAGG + Intergenic
1048420563 8:134274456-134274478 TCTGAAACTGAGATGTGGCCAGG - Intergenic
1049451323 8:142663677-142663699 TCTGGCCCCAAGATGTTGGGGGG - Intronic
1050203722 9:3176160-3176182 TCTGGCACTCAGCTGGTGACTGG - Intergenic
1053749439 9:41237061-41237083 TCTGGAGCTGAGGTCTTGGCTGG + Intergenic
1055365948 9:75544916-75544938 TCAGGCACTGATTTGTTGGAGGG - Intergenic
1055504100 9:76930622-76930644 TCACCCACTGAGATGTTTGCAGG - Intergenic
1056708637 9:88972179-88972201 CCTGGCACTGAGGTGTGTGCTGG - Intergenic
1059349425 9:113654016-113654038 TCTGGCATTGACATGCTGGGTGG + Intergenic
1059835812 9:118151039-118151061 TATGGCAGTCAGATATTGGCTGG + Intergenic
1061147432 9:128808149-128808171 TCTGGCACTGGGAGGCTGGCAGG + Exonic
1061964859 9:134007462-134007484 TCTGGAACTAAGAGGTCGGCAGG - Intergenic
1186611111 X:11139183-11139205 TTTGGCACTGAGGTGTGGCCCGG + Exonic
1186873815 X:13797684-13797706 TCTGGCACTGGTGTGTGGGCTGG + Intronic
1186891086 X:13959862-13959884 ACTGGCAGTTAGAAGTTGGCTGG + Intergenic
1187321447 X:18242114-18242136 TCTGGCACTGAGCTGGGAGCAGG + Intronic
1188049770 X:25470474-25470496 TGTTGCAATGAAATGTTGGCTGG - Intergenic
1188836252 X:34958668-34958690 TATGACACTGACATGTTGGGTGG + Intergenic
1189233901 X:39473192-39473214 TCAGGCACTGTGTTGGTGGCTGG - Intergenic
1191203894 X:57814439-57814461 CCTGTCACTGTGATGTTAGCTGG + Intergenic
1192656370 X:72999197-72999219 TCTGACACTTAGAAGTTGGGTGG - Intergenic
1192665750 X:73083804-73083826 TCTGACACTTAGAAGTTGGGTGG + Intergenic
1192950135 X:76007953-76007975 TCTGTCATTGTGATGTTAGCTGG + Intergenic
1199281066 X:145999819-145999841 TCTCTCTCTGAGAAGTTGGCAGG - Intergenic
1199283201 X:146026461-146026483 TCTCTCTCTGAGAAGTTGGCAGG - Intergenic
1201783517 Y:17747844-17747866 TCTGTCATTGTGATGTTCGCTGG - Intergenic
1201800174 Y:17946248-17946270 TCTGTCACTTTGATGTTAGCTGG - Intergenic
1201801379 Y:17959708-17959730 TCTGTCACTTTGATGTTAGCTGG + Intergenic
1201818036 Y:18158143-18158165 TCTGTCATTGTGATGTTCGCTGG + Intergenic