ID: 1038351225

View in Genome Browser
Species Human (GRCh38)
Location 8:26777898-26777920
Sequence GACTGAGGCACGTTGGTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038351210_1038351225 27 Left 1038351210 8:26777848-26777870 CCCTGGGGGCCTGCCCAGTGTGG 0: 1
1: 0
2: 5
3: 48
4: 329
Right 1038351225 8:26777898-26777920 GACTGAGGCACGTTGGTCTATGG No data
1038351216_1038351225 14 Left 1038351216 8:26777861-26777883 CCCAGTGTGGGATGGAAGTGCTG 0: 1
1: 0
2: 1
3: 20
4: 178
Right 1038351225 8:26777898-26777920 GACTGAGGCACGTTGGTCTATGG No data
1038351217_1038351225 13 Left 1038351217 8:26777862-26777884 CCAGTGTGGGATGGAAGTGCTGC 0: 1
1: 0
2: 2
3: 10
4: 156
Right 1038351225 8:26777898-26777920 GACTGAGGCACGTTGGTCTATGG No data
1038351222_1038351225 -10 Left 1038351222 8:26777885-26777907 CCACTTTTCCAGGGACTGAGGCA 0: 1
1: 0
2: 3
3: 29
4: 270
Right 1038351225 8:26777898-26777920 GACTGAGGCACGTTGGTCTATGG No data
1038351221_1038351225 -9 Left 1038351221 8:26777884-26777906 CCCACTTTTCCAGGGACTGAGGC 0: 1
1: 0
2: 1
3: 69
4: 819
Right 1038351225 8:26777898-26777920 GACTGAGGCACGTTGGTCTATGG No data
1038351212_1038351225 26 Left 1038351212 8:26777849-26777871 CCTGGGGGCCTGCCCAGTGTGGG 0: 1
1: 1
2: 2
3: 38
4: 318
Right 1038351225 8:26777898-26777920 GACTGAGGCACGTTGGTCTATGG No data
1038351215_1038351225 18 Left 1038351215 8:26777857-26777879 CCTGCCCAGTGTGGGATGGAAGT 0: 1
1: 0
2: 2
3: 11
4: 177
Right 1038351225 8:26777898-26777920 GACTGAGGCACGTTGGTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038351225 Original CRISPR GACTGAGGCACGTTGGTCTA TGG Intronic
No off target data available for this crispr