ID: 1038351380

View in Genome Browser
Species Human (GRCh38)
Location 8:26779319-26779341
Sequence ATGGAGAAGGAAAATTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 718
Summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 652}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038351380_1038351391 27 Left 1038351380 8:26779319-26779341 CCTTCCAAATTTTCCTTCTCCAT 0: 1
1: 0
2: 4
3: 61
4: 652
Right 1038351391 8:26779369-26779391 GTGAACTGGTTGTTTAAAGCTGG 0: 1
1: 0
2: 2
3: 19
4: 178
1038351380_1038351390 13 Left 1038351380 8:26779319-26779341 CCTTCCAAATTTTCCTTCTCCAT 0: 1
1: 0
2: 4
3: 61
4: 652
Right 1038351390 8:26779355-26779377 AGCACTGCTGCATGGTGAACTGG 0: 1
1: 1
2: 1
3: 13
4: 144
1038351380_1038351386 5 Left 1038351380 8:26779319-26779341 CCTTCCAAATTTTCCTTCTCCAT 0: 1
1: 0
2: 4
3: 61
4: 652
Right 1038351386 8:26779347-26779369 CCAACCCCAGCACTGCTGCATGG 0: 1
1: 0
2: 2
3: 57
4: 340
1038351380_1038351392 28 Left 1038351380 8:26779319-26779341 CCTTCCAAATTTTCCTTCTCCAT 0: 1
1: 0
2: 4
3: 61
4: 652
Right 1038351392 8:26779370-26779392 TGAACTGGTTGTTTAAAGCTGGG 0: 1
1: 1
2: 0
3: 45
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038351380 Original CRISPR ATGGAGAAGGAAAATTTGGA AGG (reversed) Intronic
900859434 1:5217632-5217654 AGGGAGAAGCAGACTTTGGAGGG - Intergenic
901342807 1:8510634-8510656 ATAGAAAAGGACAAGTTGGAAGG - Intronic
902145928 1:14399003-14399025 CTGGACAAAGAAATTTTGGAGGG + Intergenic
902896718 1:19484954-19484976 ATGGAGAAGGCAAAGGGGGAGGG + Intronic
903360596 1:22774581-22774603 AAGCAGGAGGAAATTTTGGATGG + Intronic
903629974 1:24760903-24760925 GTGGAGAATGACAATTAGGAAGG + Intronic
903793183 1:25908324-25908346 AGGGAGAAAGAAAATGTGGGGGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
905218320 1:36426138-36426160 AAGGAGAAAGAAAATTTAGAGGG + Intronic
906373046 1:45270570-45270592 ATGAAGACGTGAAATTTGGAGGG + Intronic
906477933 1:46182333-46182355 ATGGAGAAGGAGCAGTGGGAGGG + Intronic
906680274 1:47721531-47721553 GTGGAGATGGGAAATGTGGATGG - Intergenic
906769111 1:48468178-48468200 ATGGATAAAGAAAATGTGGTAGG + Intronic
906862720 1:49379027-49379049 CTGGATAAGGAAAATGTGGTAGG + Intronic
906903503 1:49864029-49864051 ATGGATAAAGAAAATGTGGTAGG + Intronic
907670946 1:56474513-56474535 TTCCAGAAGGAATATTTGGAAGG - Intergenic
908605089 1:65790068-65790090 AGTGAGATGGAAAATTGGGATGG - Intergenic
909209656 1:72807706-72807728 AAGGAGAGGGAAGAGTTGGAAGG - Intergenic
909285440 1:73810728-73810750 ATGGAGACAGAAAATTAGCAAGG - Intergenic
909503221 1:76358598-76358620 GTGGAGGAGGCAAATGTGGATGG - Intronic
909679835 1:78279262-78279284 ATTCAGAGGGAAACTTTGGATGG + Intergenic
909856770 1:80544198-80544220 ATGGAAAAGCAAAATTTAAATGG + Intergenic
910089418 1:83444880-83444902 TTAGAGAAGGAAAATATGGGTGG + Intergenic
911905563 1:103564441-103564463 ATAGGGAAGGAAAATTTGCAGGG - Intronic
912025961 1:105172742-105172764 ATGTACAAGGAAATTGTGGAGGG - Intergenic
912061907 1:105684693-105684715 ATTAAGAATGAAAATATGGAAGG + Intergenic
913368278 1:118067451-118067473 ATGGAGAAGGGAAAGAGGGAGGG - Intronic
913401623 1:118440783-118440805 ATAGGGATGGAAAATTTGGAAGG - Intergenic
913671525 1:121100924-121100946 ATGGAGAAAGAAAATCTCTAAGG + Intergenic
914023296 1:143888360-143888382 ATGGAGAAAGAAAATCTCTAAGG + Intergenic
914661779 1:149796300-149796322 ATGGAGAAAGAAAATCTCTAAGG + Intronic
915365266 1:155311595-155311617 ATGGGGAAGGAAACTGGGGAGGG + Intronic
915881245 1:159674108-159674130 CTGGAAAAGGAAAATGTAGATGG + Intergenic
916087221 1:161280227-161280249 AAGCAGAGGGAACATTTGGAGGG - Intronic
916656478 1:166880659-166880681 ATGGATAAAGAAAATGTGGGAGG - Intergenic
916679117 1:167088462-167088484 ATGGAGGAAGAAAAGTTGGTGGG + Intronic
917846385 1:179024038-179024060 ATGGAGAAGGGAAAACTGGGGGG + Intergenic
918083776 1:181227988-181228010 ATGAAGAAGGAGAAATGGGATGG - Intergenic
918122317 1:181550501-181550523 ATGGGTATGGAAAATATGGAGGG + Intronic
918551432 1:185746901-185746923 ACGAAAAAGGAAAATTTGGCTGG - Intronic
918832951 1:189422230-189422252 ATGGAGAAGGATAAAATGTATGG + Intergenic
919138108 1:193535903-193535925 ATGGATAAAGAAAATGTGGCTGG - Intergenic
919491021 1:198204925-198204947 AAGAAGAAGGAAAATTGGGAGGG - Intronic
919622324 1:199876758-199876780 ATCGAGAAGGAAAATGAGCAAGG + Intergenic
919985101 1:202668083-202668105 ATGGAGAAGGACATTTTGGTGGG + Intronic
920159773 1:203987476-203987498 AAGGAAAAGGAAAATTAGGTGGG + Intergenic
921259705 1:213374888-213374910 ATGGGGAGGGAAAATTTAAAAGG + Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
922970440 1:229731900-229731922 ATGGAGAAGCAGAATTTGGGAGG - Intergenic
923223465 1:231917059-231917081 ATGGAAATGGAAAATTTGTAAGG + Intronic
923862055 1:237901217-237901239 ATGGAAAAGGAGAATATGGGAGG - Intergenic
923909148 1:238420200-238420222 ATGGAGACCAAAAATATGGATGG - Intergenic
923986122 1:239384631-239384653 ATGGACAAGGTAAATGTAGATGG - Intergenic
924190516 1:241546862-241546884 ATGGAGAAGACAGACTTGGATGG + Intronic
924427709 1:243968443-243968465 AGGGAGAACTAAAATTTGCAAGG + Intergenic
1063078205 10:2737831-2737853 ATGGAGAAAGATAAGTTGGTGGG + Intergenic
1063248273 10:4246677-4246699 TTGCAGTAGGAAAGTTTGGAAGG - Intergenic
1063616014 10:7601121-7601143 ATGGATAAGTAAAATTTGTGGGG - Intronic
1063718438 10:8553716-8553738 ATGGAGAAGAAGAATTCGGGTGG + Intergenic
1063866946 10:10374912-10374934 ATGGAGATGGAAAAGCAGGAAGG + Intergenic
1064796752 10:19020639-19020661 TTGGAGGAGGAGTATTTGGAAGG - Intergenic
1065408158 10:25391204-25391226 GTGCAGAAGGAAAATGTGGGTGG + Intronic
1067670743 10:48318787-48318809 ATGAATAAGGAAGAATTGGAGGG + Intronic
1067787514 10:49261274-49261296 ATGGAGAAGGAAAATTGGCAGGG - Intergenic
1068017982 10:51542236-51542258 ATAGAGAGAGAGAATTTGGAGGG + Intronic
1068228793 10:54142490-54142512 ATGGTGAGGGACAATTTTGAGGG + Intronic
1068351096 10:55846084-55846106 AGGGAGAAAGAGAATTTGAAGGG + Intergenic
1068385601 10:56322933-56322955 ATGAAGAAGGAAAATTTTTTAGG - Intergenic
1068492917 10:57746503-57746525 CTGGATAAAGAAAATTTGGCAGG - Intergenic
1070939328 10:80329512-80329534 ATGGAGGATGAATACTTGGAAGG - Intergenic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071418542 10:85464337-85464359 AAGGAGAAGGAAGAGTGGGAAGG + Intergenic
1071463138 10:85917393-85917415 ATTTAGAGGGTAAATTTGGAGGG - Intronic
1071506708 10:86236781-86236803 ACAGAGAAGGAAAATGTGCATGG + Intronic
1071542242 10:86496560-86496582 ATGGATAAACAAAATGTGGAAGG + Intronic
1072535777 10:96361609-96361631 TTTGAAAAGGAAAATTTGGCCGG + Intergenic
1072541992 10:96405641-96405663 ATGGAGACGGAGGATTTGGAAGG + Intronic
1072962151 10:99939039-99939061 ATGGAGAAGTAGGATTTGGAAGG + Intronic
1073077708 10:100835113-100835135 TTGGAGAAGGGAGATGTGGATGG - Intergenic
1073103822 10:101021146-101021168 AAGGAAAAGGAAAAATGGGATGG + Intronic
1073133212 10:101204212-101204234 AAGGGGAAGGAAAGTTGGGAAGG + Intergenic
1073476242 10:103755980-103756002 AGGGAGGAGGCAAATGTGGAGGG - Intronic
1073535508 10:104273162-104273184 ATCAAGAAGGACAAATTGGATGG - Intronic
1073630164 10:105140359-105140381 ATGGAGAAAGAATAGTTGAACGG - Intronic
1073823335 10:107291145-107291167 AAGGGGAGGGAAAATTGGGAAGG - Intergenic
1073823445 10:107291782-107291804 GTGGAGAGGGAAAAGTGGGAAGG - Intergenic
1073912624 10:108364211-108364233 AGGGAGGAGGAAAATATTGAAGG - Intergenic
1074006466 10:109430043-109430065 ATGGAGAGGGTAAAGTTGTAGGG + Intergenic
1074342056 10:112641674-112641696 ATGGGAAAGGAACATTTGGAAGG - Intronic
1074453032 10:113574872-113574894 AGGGAGAAAGAAAAAGTGGAAGG - Intronic
1075007396 10:118840782-118840804 ATGGATGAGGAAATTTTGGCTGG + Intergenic
1075075532 10:119347945-119347967 GTGGAGAAGGAAAGGTTGGGGGG - Intronic
1075847602 10:125557540-125557562 ATGTTGAAGGGAAACTTGGAGGG - Intergenic
1075937378 10:126354169-126354191 ATGAGGAAGGCAAATCTGGAAGG - Intronic
1076175384 10:128364081-128364103 AGGGAGAAGGAACACTTGGAAGG + Intergenic
1076493320 10:130878905-130878927 GTGCAGAGGGAAAATTTGGTTGG + Intergenic
1078235387 11:9479968-9479990 GTTGAAAAGGAAAATATGGAGGG - Intronic
1078453042 11:11454449-11454471 AGGGAGAAGGAAGATAAGGAGGG + Intronic
1079085252 11:17440456-17440478 ATAGACAGGGGAAATTTGGAAGG - Intronic
1079437038 11:20466484-20466506 ATGCTGAATGAAGATTTGGAAGG - Intronic
1080125038 11:28723143-28723165 ATGAACAAGTAAAATTTGGGGGG + Intergenic
1081225450 11:40516708-40516730 ATGCAGAAGAAAAATTGGGTTGG - Intronic
1081249986 11:40817589-40817611 GAGAAGAAGCAAAATTTGGATGG - Intronic
1081482566 11:43503303-43503325 ATGGTGAATGGAAGTTTGGAGGG + Intergenic
1081555526 11:44157447-44157469 AAGGAGAGGGAAAAGTGGGAAGG - Intronic
1081852783 11:46285316-46285338 ATGGAGGAGGAATATTTGGGTGG + Intronic
1082079296 11:47999778-47999800 AAGGAGAAGGAAAACTAGGGGGG + Intronic
1082123084 11:48401051-48401073 ATGGAGAAGGATATTTTATAAGG + Intergenic
1082126993 11:48444865-48444887 ATGGAAAAAGAAATTTTTGAAGG - Intergenic
1082556787 11:54572339-54572361 ATGGAGAAGGATATTTTATAAGG + Intergenic
1082778904 11:57270994-57271016 ATGGACAAGGAACATGGGGAGGG - Intergenic
1084278505 11:68069937-68069959 ATTGAGAAGGAAAATGTCAAAGG - Intronic
1085248736 11:75127044-75127066 ATTGAAAAGGAAAATTTGGCTGG + Intronic
1085372247 11:76020055-76020077 AAGGAGAGGGAAAAGTGGGAAGG - Intronic
1085789531 11:79485266-79485288 GTGGTCTAGGAAAATTTGGAGGG + Intergenic
1086439451 11:86813728-86813750 ATGGAGAAGGAGACTTATGAAGG + Intronic
1087538356 11:99482068-99482090 AAGGAAAAGGTAAATTTTGAGGG + Intronic
1087908359 11:103725136-103725158 ATGGAGATGGGAAATTTGTTGGG - Intergenic
1087922383 11:103881303-103881325 ATGGTAGAGGAAAATGTGGAAGG - Intergenic
1088109967 11:106249883-106249905 ATGGAGATGGAAATTTATGAGGG + Intergenic
1089712179 11:120323519-120323541 CTGGAGAAGTAAAACATGGAAGG - Intergenic
1090045462 11:123328332-123328354 TGGGAGAAGGATGATTTGGAAGG + Intergenic
1090195157 11:124809258-124809280 ATGCACAAGGAAACTTTTGAGGG + Intergenic
1092590685 12:9951326-9951348 ATGCAGAAGTCAAATTTGAAAGG - Exonic
1093434257 12:19117627-19117649 AAGTAGTAGGAACATTTGGAAGG + Intergenic
1093543007 12:20310167-20310189 ATTTAGAAATAAAATTTGGAGGG + Intergenic
1093868349 12:24256203-24256225 GTGCAGAAGGAAAATGTGAACGG + Intergenic
1094012625 12:25825252-25825274 ATTTAGAATGAAAATTTAGATGG + Intergenic
1094069016 12:26392399-26392421 TTGAAGAAGGAATACTTGGAAGG - Intronic
1094234671 12:28150115-28150137 ATGGATAAAGAAAATGTGGCAGG - Intronic
1094342313 12:29426596-29426618 ATGGAGATGGAAAATATGACAGG - Intronic
1095391708 12:41714940-41714962 CTGGAGAGGGAAACTTTGGATGG + Intergenic
1095525684 12:43122323-43122345 ATGGGGCAGGAACATTTGTAAGG + Intergenic
1097344903 12:58480087-58480109 ATCTACAAGGAAATTTTGGATGG + Intergenic
1098030010 12:66243706-66243728 ATGGCGAAGGAAACTGTGGGTGG + Intronic
1098225705 12:68320610-68320632 AAACAGAAGGATAATTTGGATGG - Intronic
1098373945 12:69791928-69791950 ATGGATAAAGAAAATGTGGGGGG + Intronic
1098420716 12:70294209-70294231 GTGAAGAAGGAAAGGTTGGAGGG - Intronic
1098576029 12:72043313-72043335 AGGGAGAAGGAAAGAATGGATGG - Intronic
1098588073 12:72178959-72178981 ATATAGAAGAACAATTTGGAAGG + Intronic
1098754170 12:74337142-74337164 GTGGAGAAGGAAAATGTGGTAGG + Intergenic
1099079429 12:78157893-78157915 ATGGAGAAAAACAATTTGTAGGG - Intronic
1099346225 12:81503262-81503284 ATAGTGAAGGACTATTTGGAGGG - Intronic
1100544994 12:95593160-95593182 ATTGAGAAAGAAAATTTGTCAGG - Intergenic
1100574331 12:95875662-95875684 GTGAAGCAGGAAAATTGGGAGGG - Intronic
1100581785 12:95946290-95946312 ATGTTGAAGGAAAAATTGGTGGG + Intronic
1100715472 12:97301159-97301181 ATGGACAATAAAAATGTGGAAGG - Intergenic
1101278895 12:103229642-103229664 ATGGAAAATAAAAATGTGGAAGG - Intergenic
1101519091 12:105465121-105465143 AGGGAGAATGGACATTTGGAAGG + Intergenic
1101831123 12:108257366-108257388 ATGGAGGAGGGAAATTTGAGAGG + Intergenic
1101956271 12:109215115-109215137 AGGGAGAAGCAAAATTTACATGG + Intronic
1102746988 12:115258064-115258086 ATGGAGAGGAAAAATGGGGAAGG - Intergenic
1104390325 12:128386426-128386448 ACGGAAAGGGAAAATGTGGAGGG - Intronic
1104524282 12:129503850-129503872 GAGGAGGAGGAAAATCTGGAAGG - Intronic
1105059432 12:133134980-133135002 ATGGAGAAAGGAAATGTGGCTGG - Intronic
1105574629 13:21638737-21638759 ATGCAGAAGCATATTTTGGAGGG - Intergenic
1105627617 13:22128356-22128378 ATTGAGAAGAAATATTTGAAAGG + Intergenic
1106563228 13:30864296-30864318 AATGAGAAGGAAGATGTGGAGGG - Intergenic
1106593042 13:31114297-31114319 ATGGAGTTGGGGAATTTGGAGGG + Intergenic
1106790361 13:33149569-33149591 ATTCAGAAGGAAGATTTGGATGG - Intronic
1107045079 13:35985183-35985205 GTGGAGAAGGATGATGTGGAAGG - Intronic
1107210923 13:37852885-37852907 AAGGAGAAGGAAGAGTGGGAAGG + Intronic
1107481027 13:40786458-40786480 ATGGAGAGGAGAAATGTGGAAGG + Intergenic
1107552152 13:41487325-41487347 ATGGAGAGGGAAGAGTGGGAAGG - Intergenic
1108176512 13:47798213-47798235 ATGGGGAGGGAAAACTGGGAGGG + Intergenic
1108238094 13:48430085-48430107 GTGGAGAATGCAAATTAGGAGGG - Intronic
1108309356 13:49171432-49171454 TTGTAGAAGGAAAATTCAGATGG + Intronic
1108373631 13:49793675-49793697 ATGAAAGAGGGAAATTTGGATGG + Intergenic
1108479220 13:50850842-50850864 ATGGATAAAGAAAATGTGGTGGG + Intergenic
1108513845 13:51178824-51178846 ATGTAAAGGGAACATTTGGAGGG - Intergenic
1108843146 13:54646144-54646166 ATGGAAAACAAAAGTTTGGAAGG - Intergenic
1108874825 13:55032770-55032792 AGGAAAAAGGAAAATTTGGTAGG + Intergenic
1109003587 13:56838078-56838100 ATAGATAATGAAAACTTGGAAGG + Intergenic
1109671402 13:65613322-65613344 TTGGAGAAGGGATCTTTGGAAGG - Intergenic
1109881694 13:68486825-68486847 ATGGTGAAGGAAAATGGTGAAGG - Intergenic
1110028921 13:70580364-70580386 ATGGAGATGGGAAATTGGCATGG + Intergenic
1110349030 13:74485371-74485393 CTTGAGAATGAAAATTTGAACGG - Intergenic
1110872991 13:80474468-80474490 ATGGAGAAGGTCATTTTAGAAGG + Intergenic
1110873992 13:80487257-80487279 CTGGAGAAGATAAATGTGGATGG + Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111682966 13:91466681-91466703 ATTGAGAAGGAAAATTTCAGAGG + Intronic
1112218161 13:97457719-97457741 ATGGAGGAAAATAATTTGGAAGG + Intronic
1114301025 14:21378055-21378077 ATGGAGCAGGATAATGTGGGGGG + Intronic
1114460358 14:22882694-22882716 GTGGAGAAGGAAAAGGTGGCAGG + Intergenic
1114511810 14:23268531-23268553 ATGGAGGAGGAAATTTTTGGAGG + Intronic
1114707303 14:24740189-24740211 TTGGAGAAAGAAAAAATGGAGGG - Intergenic
1115154739 14:30325258-30325280 ATGGAGCAAGAAAGTTTGAATGG + Intergenic
1115314310 14:32010079-32010101 GTGGAGGAGGAAAATGTGGGTGG + Intronic
1115440014 14:33423907-33423929 TTGAAGAAGGAAAAAATGGAGGG - Intronic
1115710629 14:36046933-36046955 ATGGGGAAGCATAATTGGGAGGG - Intergenic
1115801276 14:36996691-36996713 ATGGAGAAAAAAAAAGTGGATGG + Intronic
1116100643 14:40429666-40429688 ATGCAAAAGGAAAATCTTGAAGG + Intergenic
1116906111 14:50405201-50405223 ATGAAGAAAGAAAATGTGGCTGG - Intronic
1117265340 14:54080486-54080508 ATGGGGAAGAGAAATATGGATGG - Intergenic
1117335745 14:54755756-54755778 GTGGAAAAGGAAAATTAGAATGG + Intronic
1117527344 14:56622393-56622415 ATGGGCAAGGTAAATTTGAATGG - Intronic
1117616176 14:57535976-57535998 AAGGAGAAGGAAAATATCTATGG + Intergenic
1117730800 14:58719991-58720013 ATGGAGAAGGCAAAAATGGAAGG + Intergenic
1118701197 14:68434889-68434911 ATGGATAAAGAAAATGTGGTGGG - Intronic
1118946150 14:70389296-70389318 TGGGAGAAGGAAAGTGTGGAAGG - Intronic
1119113081 14:71993918-71993940 AGGGAAAAGGAAGAGTTGGAAGG + Intronic
1119200471 14:72748214-72748236 ATGGAGATGAAAAATTTGTTGGG + Intronic
1119251870 14:73162816-73162838 ATGTAGAAAGAAACTTTGAAAGG + Intronic
1119531886 14:75367557-75367579 ATGAAGAAGGAAAAAAAGGAAGG + Intergenic
1119707716 14:76795741-76795763 AAAGAAATGGAAAATTTGGATGG - Intronic
1120193981 14:81463372-81463394 GAGGAGAAGGACAATTAGGAGGG - Intergenic
1120289870 14:82554160-82554182 ATGGGCATGGAAAATTTGGGAGG - Intergenic
1120309459 14:82811186-82811208 ATGTAGAAGGAGGATATGGAGGG - Intergenic
1120484297 14:85091460-85091482 ATGAAGAAGGAAATATTTGAGGG - Intergenic
1120599441 14:86483328-86483350 AGGTAGAGGAAAAATTTGGAGGG - Intergenic
1120655856 14:87189132-87189154 AAGCAGAAGGAGAATTTGGATGG - Intergenic
1120690892 14:87591059-87591081 ATGAGGAAGGAAAATGAGGATGG + Intergenic
1120764414 14:88315725-88315747 ATAGAAAATGAAAATTTGGTCGG - Intronic
1121940100 14:98062491-98062513 ATGGGCAAGGAGAACTTGGAAGG - Intergenic
1122218738 14:100221852-100221874 AGGGAGAAGGAATATTGGGGAGG + Intergenic
1124382307 15:29177050-29177072 TGGGAGAAGGAAGAGTTGGAGGG + Intronic
1125105941 15:35971313-35971335 ATGGATGAGGAAAACTTGGCTGG - Intergenic
1125107293 15:35987291-35987313 TTAGAGAAAGCAAATTTGGATGG + Intergenic
1125163349 15:36673721-36673743 ATGGAAAAAAAAAATTTGGCAGG + Intronic
1125247505 15:37658256-37658278 ATGGATAAAGAAAATGTGAAGGG + Intergenic
1125839641 15:42787307-42787329 AGGGAGAATGAAAGTTTAGAAGG - Intronic
1125910379 15:43432618-43432640 GAGGAGAAAGAAAAATTGGAGGG - Exonic
1126183838 15:45811383-45811405 AAGGAGAAGGAAGAGTGGGAAGG + Intergenic
1126208941 15:46077937-46077959 ATGGAAAAGGAGAGTTTGGCAGG + Intergenic
1126240226 15:46433410-46433432 ATTTAGGAGGAAAAATTGGAAGG + Intergenic
1126341210 15:47642899-47642921 ATGGAGAAGGAAATGCGGGAAGG + Intronic
1126722590 15:51597267-51597289 ACGGAGAAGTGTAATTTGGAAGG - Intronic
1127107855 15:55636371-55636393 AAGGAGAAGGAAACACTGGAAGG - Intronic
1127341391 15:58048524-58048546 ATTGAGAAGGGAAGTATGGATGG + Intronic
1128029969 15:64471387-64471409 CTGGAGTAGAAAAATTTGGTAGG + Intronic
1128686175 15:69687342-69687364 AGGGAGAAGGAAAGTTAGGAAGG + Intergenic
1129651809 15:77496439-77496461 ATGGAAAAGGAGAAACTGGATGG - Intergenic
1130549876 15:84883549-84883571 ATGCAGAAGAAAAAGTTGTATGG + Intergenic
1131321113 15:91392103-91392125 CTGGAGAAGACAAATATGGATGG + Intergenic
1131768218 15:95704022-95704044 ATGCTGAAGGATAATTTGAAAGG + Intergenic
1132666920 16:1085310-1085332 ATGGAGGAGGAAAACTTGAGAGG - Intergenic
1135045757 16:19153793-19153815 ATGGAGACAGAAGACTTGGATGG + Intronic
1135886926 16:26318618-26318640 ATGGAGAGGGAAAGTTCAGAAGG - Intergenic
1136051921 16:27657224-27657246 ATTGAGAAGGAAAAAGTGGGAGG + Intronic
1136527028 16:30837907-30837929 ATAGAGGAGGAAAAATTGTAGGG - Intronic
1137334060 16:47531000-47531022 TTGGAGAAGGAAAAATATGAAGG + Intronic
1137535734 16:49323661-49323683 ATGTTGAAGGAAAATTAGAAGGG - Intergenic
1137851444 16:51749173-51749195 ATGAAGAAAGGAAATTCGGAAGG - Intergenic
1138041946 16:53680840-53680862 AGGGAGAAGGAGAAATAGGAGGG + Intronic
1138897033 16:61219046-61219068 TTTCAGAGGGAAAATTTGGATGG + Intergenic
1140770938 16:78203400-78203422 ATGGAGAAGAGAAATTTGTTAGG + Intronic
1141231893 16:82175497-82175519 ATAGAGATGGAAGATGTGGAAGG + Intergenic
1141263445 16:82474512-82474534 CTGGAGAAACAAAATCTGGAAGG + Intergenic
1141862528 16:86727729-86727751 AAGGAGAAAGAAAATATGGTCGG + Intergenic
1143499019 17:7328176-7328198 AGGAAGTAGGAGAATTTGGATGG - Intronic
1143891335 17:10104780-10104802 GTGGAGAAGGAAAATGTGGATGG - Intronic
1146158285 17:30542663-30542685 ATGGAGTAGGTAAATTTCCAGGG - Intergenic
1146775377 17:35609783-35609805 ATGGAGAATTAGAATTTGGCTGG + Intronic
1146933602 17:36795649-36795671 ATGGATAAGCAAAATGTGGTAGG - Intergenic
1147162158 17:38574637-38574659 TTGGAGAAGGAATTTTTTGAGGG - Intronic
1147917369 17:43896773-43896795 ATGGAGCAGGAAGATTCAGAAGG - Intronic
1148244722 17:46023132-46023154 ATTGCAAAGGAAAATGTGGAAGG - Intronic
1148908747 17:50928389-50928411 ATGGAGCAGAAAAGTTTGGGAGG - Intergenic
1148923267 17:51059466-51059488 CTGGATAAAGAAAATTTGGTGGG + Intronic
1148963699 17:51416406-51416428 ATTGAGATGGAAAAATGGGATGG + Intergenic
1149095982 17:52841565-52841587 ATGGAGAACTAAGATTAGGATGG + Intergenic
1151305538 17:73260802-73260824 CTGGGGAGGGAAAATTGGGATGG - Intronic
1151814635 17:76465684-76465706 AATGAGAAGGAAAATAAGGAGGG - Intronic
1152110973 17:78357715-78357737 AGGGGGAAGCAACATTTGGAGGG - Exonic
1153070255 18:1097657-1097679 AAGGAGAAGGAAGATTTTGCTGG + Intergenic
1153248175 18:3094174-3094196 AACGAGAAGGAAATTTTTGAAGG - Exonic
1153439714 18:5102718-5102740 ATTGAGTATTAAAATTTGGACGG + Intergenic
1153887295 18:9478181-9478203 ATGGGGAAGGAACTTTTAGAGGG + Intronic
1153950749 18:10055718-10055740 ATGTTGAAGAGAAATTTGGAAGG + Intergenic
1155091814 18:22519424-22519446 AAGGAGAAGGTTAATTTTGAAGG + Intergenic
1155277000 18:24198082-24198104 CAGTAGAAGGAAAATTTGGCTGG - Intronic
1155423190 18:25677992-25678014 TTGGAGAAGGAAAATTCTGTAGG - Intergenic
1155601206 18:27550303-27550325 ATAGAGAAGAAAAATTTAAAAGG + Intergenic
1156445672 18:37235172-37235194 AAGGACAGGGAGAATTTGGATGG + Intergenic
1156611384 18:38729150-38729172 ATGGAAAAGGACAATTTAGTAGG + Intergenic
1157167319 18:45370101-45370123 ATGGGGAAAGAATATTTGGCAGG - Intronic
1158343432 18:56490420-56490442 GTGGAGAATGAAAGTTAGGAAGG + Intergenic
1158364229 18:56713090-56713112 ATGGGCAGGGAAAATATGGATGG + Intronic
1158490768 18:57907491-57907513 ATGGAGAAAAGAAATTAGGATGG + Intergenic
1158903912 18:61992435-61992457 AATGAGAAGGAAAATGGGGAGGG + Intergenic
1159022010 18:63151171-63151193 GTGGAGAAGGGAATTTTGGGGGG - Intronic
1159535928 18:69714714-69714736 ATTTAGAAGGAAATTTTGCAAGG + Intronic
1160333238 18:78014656-78014678 AAGGAAAAGGAAAATTAGTAGGG - Intergenic
1160660606 19:296658-296680 ATGGAGAAGGAATAGTAAGAGGG - Intergenic
1160676619 19:394575-394597 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676758 19:395194-395216 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676783 19:395294-395316 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676808 19:395394-395416 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160695196 19:480499-480521 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160695369 19:481421-481443 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160951276 19:1668816-1668838 ATGGGGAAGGAGAATTTCGAAGG + Intergenic
1162107253 19:8377511-8377533 ATCTATAAGGAATATTTGGAGGG - Intronic
1163099501 19:15085908-15085930 ATGGATAAAGAAAATGTGGTAGG - Intergenic
1163381898 19:16974664-16974686 ATGAAAAAGAAAAGTTTGGAAGG + Intronic
1163564312 19:18040892-18040914 ATGGAGAAGGAAAACTCCGGAGG + Intergenic
1164441987 19:28285419-28285441 ATGGGGAAGAAAAGGTTGGAGGG + Intergenic
1165116024 19:33529307-33529329 AATGAGAAGGAAAGCTTGGAAGG + Intergenic
1165859133 19:38898150-38898172 AGGAAGAAGGAAAGTTTGGGAGG + Intronic
1165913541 19:39244331-39244353 ATGGAGAAGGAGAAGGTGAAGGG + Intronic
1165974758 19:39665982-39666004 ATGTGGAAGGGAAATGTGGAAGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166165014 19:40981303-40981325 ATGGAGAAGGGAAACTTGTTGGG - Intergenic
1166524290 19:43501567-43501589 AGGGAGAAGGAAAACCAGGAGGG + Intronic
1166536664 19:43578933-43578955 AAAGAGAAGGAAAATGTGGGAGG + Intronic
1167141351 19:47652938-47652960 ATGGAAAAGTAAAATGTAGAAGG - Intronic
1168270628 19:55247814-55247836 AAGGAAGAGGAAAAGTTGGAAGG + Intronic
925628009 2:5861590-5861612 GTGTAGAAGAAAAATTTGGGGGG - Intergenic
925694800 2:6565158-6565180 TTGGAGAAGGAAAATTTGGCAGG + Intergenic
926096930 2:10087448-10087470 CAAGAGAAGGAGAATTTGGATGG - Intergenic
926317645 2:11723096-11723118 ATGGAAAAGCCACATTTGGAAGG - Intronic
927583687 2:24279586-24279608 AGGAAGAAAGCAAATTTGGAGGG + Intronic
927647115 2:24884977-24884999 AAGAAGAAGGAAAATTGGAAAGG - Intronic
928752353 2:34485714-34485736 CTGGAGTAGGAAAAGTGGGATGG - Intergenic
929259219 2:39845733-39845755 CTTGAAAAGGAAAATGTGGAGGG + Intergenic
929769784 2:44881903-44881925 ATGGATAAGGAAAGAATGGAAGG - Intergenic
929981689 2:46687276-46687298 ATGGAAAAGGTGAATTTGGCTGG + Intergenic
930544342 2:52747411-52747433 ATGGGGAAGGATAATTTTCAAGG + Intergenic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930729483 2:54713635-54713657 AAGGAGAAGGAAAGTCTAGATGG + Intergenic
930763176 2:55058143-55058165 AAGGAGAGGGAAAAGTTGGAGGG + Intronic
931061520 2:58534714-58534736 ATAAAGAAGGTAAATTTGAATGG - Intergenic
931811036 2:65855353-65855375 CTGTAGAAGGAAAATTTTGTGGG - Intergenic
932038558 2:68274019-68274041 ATGGAGAAGGAAAAATCCTAAGG + Intergenic
932112124 2:69011342-69011364 ATGGAAGAGGAAGACTTGGATGG + Intergenic
932143216 2:69297486-69297508 AAGGAGAAGGAAAATGTGTGTGG - Intergenic
933121057 2:78539004-78539026 CTGGAGAAGGAAATGATGGAAGG + Intergenic
933197860 2:79412780-79412802 ATTGAGAAGGAGAAACTGGATGG + Intronic
933387907 2:81634652-81634674 AAGGAGAAGGAAAAGTGGGAAGG + Intergenic
933637292 2:84721966-84721988 ATAGAGAAGGGAATCTTGGAAGG + Intronic
933735555 2:85491169-85491191 ATTGAGAAGGAAGATTGAGAAGG - Intergenic
934805189 2:97216525-97216547 ATGGATGAAGAAATTTTGGAAGG + Intronic
935446431 2:103161445-103161467 GAGGAGAAGGAAAATATGGAGGG + Intergenic
935660221 2:105460464-105460486 ATGGAGAAGAAAAATGTAGGAGG + Intergenic
936560824 2:113538379-113538401 ATGGAGAAAGGAAACTTAGAGGG - Intergenic
936839538 2:116753533-116753555 ATGGGGAAGGAAGGTTGGGAGGG - Intergenic
937431315 2:121841012-121841034 ATGAAAAAGCAAAATTTGGTTGG - Intergenic
937518820 2:122686093-122686115 ATGGAGATGAAGAATTTGTAGGG - Intergenic
940038500 2:149334152-149334174 ATGAAAAAGGAAAATTTGAAGGG + Intronic
940315115 2:152320246-152320268 AAGGAGAAGGAAAAGTGGGAAGG - Intergenic
941260158 2:163287659-163287681 CTCCAGAAAGAAAATTTGGAAGG - Intergenic
941527237 2:166621241-166621263 ATGGATAAAGAAAATGTGGCTGG - Intergenic
941622413 2:167793151-167793173 ATGGAGAGTGAAAAGATGGAGGG - Intergenic
941764275 2:169279444-169279466 ATAGATATGGTAAATTTGGATGG - Exonic
941866774 2:170343563-170343585 ATGGGGAAGGAACAGTGGGAAGG + Intronic
942137330 2:172939846-172939868 ATGGAGCTGGAAAAACTGGATGG - Intronic
942165731 2:173238998-173239020 ATGGAGGATGCAAATGTGGATGG - Intronic
942663415 2:178290141-178290163 ATGTAGAAGGAATAATAGGATGG - Intronic
943424999 2:187720257-187720279 ATGAAGAAAGAAAATATGAAAGG + Intergenic
943437749 2:187887318-187887340 ATGTAAAAAGAAAATTTGAAAGG - Intergenic
943762402 2:191624053-191624075 AGAGAGAATGAAAATTTGAAGGG - Intergenic
944020046 2:195091745-195091767 ATGGATAAGGAAAATTTCCAAGG + Intergenic
944086948 2:195860079-195860101 TTGAAAAAGGAAAATTTGAAGGG + Intronic
944382034 2:199122118-199122140 TTGGAGAACAAATATTTGGATGG + Intergenic
944467183 2:200014342-200014364 TTGGATATGGAAATTTTGGAAGG - Intergenic
944686886 2:202125540-202125562 CTGGGGAAGGATAATTTGCAGGG + Intronic
944941500 2:204632951-204632973 ATGGATAAAGAAAATATGGGAGG - Intronic
945073697 2:206015977-206015999 GTGCAGAAGGAAAATGTGGGTGG + Intronic
945777680 2:214127502-214127524 AAGGAGGAGGAGAGTTTGGAAGG + Intronic
945905631 2:215589585-215589607 ATGAAAAATTAAAATTTGGAGGG - Intergenic
946545502 2:220737733-220737755 AGGGAGCTTGAAAATTTGGAAGG - Intergenic
946753100 2:222913448-222913470 AAGGAGAGGGACAGTTTGGAAGG - Intronic
947239455 2:227978409-227978431 ATAAAAAACGAAAATTTGGAGGG - Intergenic
948322520 2:237082062-237082084 ATGGAGAAGAAGACTTTGAAAGG + Intergenic
948385863 2:237580417-237580439 ATGGAAAAGGAAAATATGAGAGG - Intronic
1168756382 20:321332-321354 TTGGAGGAGGGAAATTTGGGGGG - Intergenic
1169055268 20:2615657-2615679 AAGGAGAAAGAAGAGTTGGAAGG + Intronic
1169585984 20:7086048-7086070 ATGGAGGAGGAAAAGAAGGAAGG - Intergenic
1169615506 20:7439184-7439206 ATGGACCATGAAAATTTGGAAGG - Intergenic
1170073298 20:12392031-12392053 ATGGAGACAAAAGATTTGGAGGG + Intergenic
1170236542 20:14111975-14111997 ATGGATAAAGAAAATATGGTAGG + Intronic
1170529913 20:17281004-17281026 AAGGAGAAGGCAAATATGGCGGG - Intronic
1171077036 20:22137838-22137860 GTGCAGAAGGGAAATGTGGATGG - Intergenic
1173000859 20:39104648-39104670 ATCGAGATGGAAAATGGGGAAGG + Intergenic
1173180279 20:40801371-40801393 AAGGAGAAGGAGGATTTGGATGG + Intergenic
1173865489 20:46309743-46309765 ATGGAGATGGAAATTGGGGAAGG - Intergenic
1173947283 20:46961637-46961659 ATGGAAAAAGAAAATGTGGTAGG + Intronic
1174180233 20:48669838-48669860 ATGGAGAAGGCAAAGTGGGGTGG + Intronic
1174831796 20:53820331-53820353 AAGGAGAGGGAAAAGTGGGAAGG - Intergenic
1174957872 20:55120876-55120898 AGGGAGAAAGAAAATTTTGCTGG + Intergenic
1177212900 21:18091873-18091895 AAGGGGAAGGAAAAGTGGGAAGG + Intronic
1177372878 21:20228575-20228597 ATATAAAAGGGAAATTTGGATGG + Intergenic
1178036594 21:28590544-28590566 ATGGTGAACTGAAATTTGGAAGG + Intergenic
1178715892 21:34963964-34963986 ATGTAGATGGAAGATTGGGATGG + Intronic
1180619671 22:17152628-17152650 CTGGAGATGAAAATTTTGGAAGG + Intronic
1181433371 22:22896065-22896087 ATTGAGAAGTAAAATTTAGGAGG - Intronic
1181776101 22:25161113-25161135 AAGGAGAAGGAAAGTTAGGAAGG - Intronic
1181982559 22:26775793-26775815 ATGTAGCAGGAAGATTTGGTAGG - Intergenic
1182111131 22:27724558-27724580 ATGGGGAAAGCAGATTTGGAGGG - Intergenic
1182824429 22:33252352-33252374 ATGGAGAAGGAGAGTTAGGCTGG - Intronic
1182854934 22:33508818-33508840 ATGCAAAAGGAAAATATGGCAGG + Intronic
1183322442 22:37173229-37173251 AGGGAGAAGCAAATTTGGGAGGG - Intronic
1184908902 22:47512463-47512485 GTGCAGAATGAGAATTTGGAGGG + Intergenic
949155931 3:827267-827289 ATGGAGAGGAAAAAGTGGGAAGG + Intergenic
949180578 3:1125346-1125368 ATACATAAGCAAAATTTGGAAGG + Intronic
949194886 3:1293237-1293259 AAGGAGAAAGAAAATGTGGAAGG - Intronic
949359149 3:3213507-3213529 AATGATAAGCAAAATTTGGACGG + Intergenic
950051238 3:9991387-9991409 ATGAAGAGAAAAAATTTGGAAGG - Intronic
951257745 3:20469844-20469866 ATGAAGAAGGAAAATTCTTATGG + Intergenic
952247781 3:31614408-31614430 ATGGACAAGGAAACTGGGGAGGG - Intronic
952474982 3:33699290-33699312 AGGTAGAAGAAATATTTGGAGGG + Intronic
952475740 3:33708581-33708603 ATGGATAAAGAAAATGTGGGGGG - Intronic
953197189 3:40745691-40745713 ATGGAGAAGCAAGACTGGGAAGG - Intergenic
953420523 3:42750248-42750270 CTGGAGAAGGAAGATGGGGAAGG - Intronic
953834150 3:46328646-46328668 ATGGAGGTGGAGAATATGGAAGG + Intergenic
955717625 3:61847209-61847231 ATGTAAATGGGAAATTTGGATGG + Intronic
955908904 3:63839444-63839466 ATGGAGAAGGCAGATTGGTAAGG - Intronic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
956375003 3:68604582-68604604 ATTGAGACAGAAAATTTGCAAGG + Intergenic
956419357 3:69070229-69070251 ATAGAGAAGGGAAATTTCAAAGG + Intronic
956857900 3:73294096-73294118 ATAGATGAGGAAAATGTGGATGG + Intergenic
957223513 3:77413829-77413851 ATGGACAAGTAAAATGTGGCAGG + Intronic
957592589 3:82219652-82219674 CTGGATAAAGAAAATGTGGATGG - Intergenic
957790413 3:84933285-84933307 ATGGTGAAAGACAATTTGGAGGG + Intergenic
957867017 3:86038952-86038974 ATTTAGAAGGAGAATCTGGAAGG + Intronic
958056658 3:88421156-88421178 ATAGAGAAATAAAGTTTGGAAGG - Intergenic
958613831 3:96464035-96464057 AGGGTGAAGGAAACTTTGGATGG + Intergenic
958672789 3:97226667-97226689 ATGGATAAGGAAAACTTGTAGGG - Intronic
959084738 3:101839764-101839786 AAGGAGAAAAAAAATTTTGAAGG - Intronic
959234016 3:103694370-103694392 ATTGAGCAGGAGAATTAGGAAGG + Intergenic
959365312 3:105450954-105450976 ATGTAGAGGGAGAATTAGGATGG + Intronic
959502108 3:107118544-107118566 ATGGCAGAGGAAAATTTGGCAGG + Intergenic
959533787 3:107463040-107463062 AGGCAGAAGGAAACTTTTGAGGG + Intergenic
959813718 3:110650675-110650697 AGGGAGAAGGAGATTTTGAAGGG + Intergenic
959858106 3:111185041-111185063 TTGGAGAAAGAAAATTTGCTAGG - Intronic
960373485 3:116869788-116869810 ATGGAGAAAGTAAAGTTGGGAGG - Intronic
960573963 3:119211292-119211314 GTGGGGAAGGAGAATTTGAAAGG - Intergenic
960708042 3:120500266-120500288 GTGGAGAAGGAAACTTGGGGTGG + Intergenic
961183870 3:124897789-124897811 AAGGATAAGGAAATTTTGTAAGG + Intronic
961212160 3:125133890-125133912 GTGCAGAAGGAAACTTTGGGGGG - Intronic
961226206 3:125249792-125249814 ATGGATAAAGAAAATGTGGGGGG + Intronic
962987625 3:140550034-140550056 ATGGAGATGAAAAATTGGCAGGG - Intronic
962987788 3:140551485-140551507 ATGGAGATGAAAAATTGGCAGGG - Intronic
963441624 3:145346933-145346955 ATGAACAAGGTTAATTTGGAAGG + Intergenic
963806210 3:149725665-149725687 TTTCAGAAGGAAAATTTTGAAGG + Intronic
963822933 3:149919375-149919397 AGGATGAAGGAAAAGTTGGAAGG - Intronic
964037317 3:152215164-152215186 GAGGAGAAGGAAATTTTGGGTGG + Intergenic
964183137 3:153912047-153912069 AAGGAGAGGGAAAAATGGGAAGG - Intergenic
964414964 3:156437837-156437859 AGGATGAAGAAAAATTTGGAAGG - Intronic
964646502 3:158963697-158963719 AAGGAGAAGCAAAATTTGATGGG + Intronic
965395922 3:168160413-168160435 ATGGAGAAGGAAGTTTTAGTTGG + Intergenic
965397831 3:168181833-168181855 GTGAAGAAGGGAAGTTTGGAAGG + Intergenic
965891250 3:173516515-173516537 AGGTGGAAGGAAAAGTTGGAAGG - Intronic
966241636 3:177760796-177760818 TTGGAGAAGGAAAAAGTGGTTGG + Intergenic
966767405 3:183475674-183475696 AAGGAGAAGAAAAATGTAGATGG + Intergenic
969154382 4:5197132-5197154 ATGAAGAAGGACAATAGGGAGGG + Intronic
970147705 4:13054182-13054204 ATAGAGAAACAAAATCTGGAGGG - Intergenic
970218840 4:13786497-13786519 ATGAAGAAGGAAAAAAGGGAGGG - Intergenic
970458815 4:16252473-16252495 ATACACAAGAAAAATTTGGAGGG - Intergenic
970510438 4:16776789-16776811 AAGGAGAAGTAAAATTTACATGG + Intronic
970777090 4:19688034-19688056 ATGGAGCTGGAAAAATTGTAGGG + Intergenic
970810758 4:20091191-20091213 ATTGAGACTGAGAATTTGGAGGG + Intergenic
971353620 4:25874504-25874526 AAGCAGAAGGAAAATAAGGAGGG + Intronic
971415624 4:26425694-26425716 AAGGAGAGGGAAAATTGGGAGGG - Intronic
971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG + Intergenic
971870977 4:32238093-32238115 ATGCTGAAGGAAAATTGGAATGG + Intergenic
973017731 4:45162755-45162777 ATAAAGAAGGAAACTTTGGAAGG - Intergenic
973797098 4:54438677-54438699 ATGGATAAAGAAAATGTGGTGGG - Intergenic
973936483 4:55851742-55851764 ATGGTGAGGGAAAATTAGAATGG + Intergenic
974561250 4:63521861-63521883 AAGGAGAAGAAAAAATTTGAGGG + Intergenic
974593305 4:63983724-63983746 ATGGAGAAGGAAGATTTTGGAGG - Intergenic
974766303 4:66350971-66350993 ATAAAGAATGAAAATTTGGATGG + Intergenic
975545901 4:75560314-75560336 ATGAAGAATGAAAATTTTGAGGG + Intronic
976018118 4:80585141-80585163 ATTTAGAAGGCAAATTTGGCAGG + Intronic
976776217 4:88708998-88709020 CTTAAGAAGGAAAATGTGGATGG + Intergenic
976982126 4:91244186-91244208 AAGGGGAAGGAAAAGTGGGAAGG + Intronic
977181770 4:93883838-93883860 TTGGGGAGGGAAACTTTGGAGGG - Intergenic
977839214 4:101681369-101681391 ATGGATAAATAAACTTTGGACGG - Intronic
978126326 4:105140122-105140144 ATGGAGAAGGCAAATTAAAAAGG - Intergenic
978135206 4:105249319-105249341 ATGGAAAAAGAAAATGTGGCTGG - Intronic
978293983 4:107181666-107181688 ATGGGGAGGGAAGCTTTGGAAGG - Intronic
978448974 4:108808259-108808281 ATAGTGGAGGAAAATTAGGAGGG + Intergenic
980029564 4:127811550-127811572 ATTGAGAAGCAAAATTTGGAAGG + Exonic
980276992 4:130665665-130665687 ATGAAGAATGACAAATTGGAAGG - Intergenic
980646035 4:135643533-135643555 ATGGAGATGGGAAATTTGTTGGG + Intergenic
980651012 4:135714434-135714456 ATAAAGAAGGAAAATTAGGCTGG - Intergenic
980999246 4:139812414-139812436 GTGGAGAGGGAAAAGTAGGATGG - Intronic
981271569 4:142851610-142851632 AAGGCGAAGGAAAAATGGGAGGG + Intergenic
981773145 4:148333553-148333575 TTGGAGAATGAAAAGTTGGAAGG + Intronic
981918100 4:150056896-150056918 AAAGAGGAGGAAAATGTGGAGGG - Intergenic
981945366 4:150336565-150336587 GGGGAGAAGGAAAATTAGGGAGG + Intronic
982309333 4:153968194-153968216 ATTGTGAAAGGAAATTTGGAAGG - Intergenic
982397563 4:154928506-154928528 ATGGAGAAGGAAATGAGGGAAGG + Intergenic
982418782 4:155168937-155168959 TAGGAGAAGGGAGATTTGGAAGG - Intergenic
982501878 4:156167898-156167920 ATGGAGTAGGGAAACTTTGAAGG + Intergenic
982742158 4:159068786-159068808 ATAGAAAAGGTAAATTGGGATGG + Intergenic
982924243 4:161316043-161316065 ATGAAGAGGGAAAATTAGGATGG + Intergenic
983990737 4:174116492-174116514 ATTGAGAAGGAAAAATTACAAGG - Intergenic
984136840 4:175951926-175951948 ATGGTGTAGGGAAAGTTGGAAGG - Intronic
985324423 4:188752032-188752054 TGGGAGAAGGAAATTTCGGAAGG - Intergenic
987190883 5:15477198-15477220 AGGGAGAAGGAAAATGGGGAGGG - Intergenic
987581494 5:19799477-19799499 ATACATAAGGAAAATTTTGAGGG + Intronic
988584093 5:32493888-32493910 ATAGTGAAGCAAAACTTGGAAGG + Intergenic
988633407 5:32955600-32955622 AGGGAGTAGGAAATTTTGGGGGG + Intergenic
988832654 5:35002925-35002947 ATGGAGCAGGGAAACTGGGAAGG + Intronic
988899290 5:35714857-35714879 ATGCAGAAGAAAATTTTGCAAGG - Intronic
989021069 5:37010059-37010081 ATGAAGAAAAAAAATTTGTATGG - Intronic
989214363 5:38888599-38888621 ATGGAGAAAGAAAAGAGGGAAGG - Intronic
989522980 5:42423216-42423238 ATGGAAAGGCAATATTTGGATGG + Intergenic
989654620 5:43733135-43733157 AAGGAGAAGGAAAAAGTGGTGGG - Intergenic
990251383 5:53918998-53919020 ATTGGGAAGGAAAATTTCAATGG + Intronic
990262286 5:54036416-54036438 ATGTAGAAGTAGAAATTGGATGG - Intronic
990774269 5:59287335-59287357 AAGGAGAAGGAAGAGTGGGAAGG + Intronic
992537357 5:77721058-77721080 ATGGGTGAAGAAAATTTGGATGG + Intronic
993071198 5:83166181-83166203 ATGGATAAGAAAAATGTGGCCGG - Intronic
993652600 5:90540184-90540206 ATGGAAAATGAATATTTGTAAGG + Intronic
993658164 5:90597881-90597903 ATAGAGATGGATAATTTTGAGGG + Intronic
993710529 5:91220303-91220325 ATGGAGAAAGAGAATTAGAAAGG + Intergenic
993817400 5:92568337-92568359 AAGGAAAAAGAAAATTTGAATGG + Intergenic
994305815 5:98202711-98202733 ATGAAGAAGGAAACTTTATAAGG - Intergenic
994450568 5:99936406-99936428 ATGGAGAAGGTAAACCAGGATGG + Intergenic
994504720 5:100628287-100628309 ATGAAGAAGCACACTTTGGATGG - Intergenic
994842170 5:104939011-104939033 ATGAAAATGGTAAATTTGGATGG - Intergenic
995426099 5:112024520-112024542 ATGAAGAGGGTAGATTTGGAAGG + Intergenic
995816681 5:116177194-116177216 ATGGAGATGGGAAACTTGGGAGG + Intronic
996313092 5:122129043-122129065 ATAAAGCAGGAAAATGTGGAAGG - Intergenic
996367776 5:122721206-122721228 ATGGAGAAGGAAAGGAAGGAAGG + Intergenic
997028672 5:130096826-130096848 AAGGAGGAGGAGAATCTGGAAGG + Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997281209 5:132647277-132647299 ATGAAGAAGCAGATTTTGGATGG - Intergenic
998873682 5:146577514-146577536 ATGTAAATGGAAAAATTGGATGG + Intergenic
998889457 5:146730448-146730470 GTGGAGACGTGAAATTTGGAGGG + Intronic
999325002 5:150638464-150638486 ATGGTGAAGCAAAATGTGAAGGG + Intronic
999869432 5:155733689-155733711 GTGGAGAAGTAAAAGTTGAAAGG + Intergenic
1000050308 5:157557231-157557253 ATGAAGAAGTAAAACTTAGAAGG + Intronic
1000228145 5:159289814-159289836 ATGGAGAAGAATATTGTGGAAGG + Intergenic
1000967101 5:167670835-167670857 ATGGGGAAGGAAAAATGGCAAGG - Intronic
1001196627 5:169678920-169678942 ATGGAGAAGAGAAACTCGGAGGG + Intronic
1001427939 5:171636621-171636643 ATGGAGAAGGAATATGTAGTAGG + Intergenic
1002136655 5:177111992-177112014 AGGTAGAAGGAAGAGTTGGAGGG + Intergenic
1003528474 6:6917993-6918015 AAGCAGAGGGAGAATTTGGAAGG + Intergenic
1003792712 6:9565120-9565142 TTGGAGAAAGAAAATAAGGAAGG - Intergenic
1005098081 6:22140600-22140622 GTAGAGAAGGAAAATCTGGATGG + Intergenic
1005279264 6:24254487-24254509 ATGGAGATGAAAAATTTCTATGG - Intronic
1006000183 6:30958525-30958547 AAGGAGAAGGAAAAACTGGAAGG - Intergenic
1007434281 6:41797406-41797428 GTGATGAAGGAAAATTTAGAAGG + Intronic
1008008158 6:46434441-46434463 ATGAGGAAGGAATATTTGGAGGG + Intronic
1008660802 6:53665689-53665711 AGGGAGAAGGAAAATCCGGTGGG + Exonic
1008806067 6:55430095-55430117 CTGGAGAAGGAAAGTTTAGATGG + Intergenic
1008891845 6:56502900-56502922 ATGGAGAGTTAAAATTGGGAAGG + Intronic
1008974862 6:57413253-57413275 GGGGAGAAGGAAAAAATGGAGGG + Intronic
1009163747 6:60314759-60314781 GGGGAGAAGGAAAAAATGGAGGG + Intergenic
1009450276 6:63791960-63791982 ATTTGGAAGGAAAATTTGAAAGG + Intronic
1009611643 6:65950318-65950340 AAGGAGAAGGAAAATGTGGTTGG - Intergenic
1009827082 6:68880489-68880511 ATGGAGAGGGATGTTTTGGAGGG - Intronic
1010514236 6:76753596-76753618 AGGGAGAAGGAAGAGTGGGAAGG + Intergenic
1011302270 6:85888892-85888914 ATGGATAAAGAAAATGTGGTGGG - Intergenic
1011599385 6:89045704-89045726 ATGGAGATGGAAAAGTATGATGG + Intergenic
1011979435 6:93354153-93354175 ATGGAGAATGATAATTTCAAGGG + Intronic
1012362412 6:98398958-98398980 TTGGAGAAATAAAACTTGGAAGG - Intergenic
1012515540 6:100054744-100054766 ATGGATAAAGAAAATGTGGTAGG - Intergenic
1013347975 6:109280751-109280773 ATGTAGAGAGAAAATTCGGAGGG + Intergenic
1013570727 6:111422016-111422038 ATGGAAAAAGAAAAGTTGTAAGG + Intronic
1014421736 6:121254230-121254252 GTACAGAAGGAAAATTTGGAAGG + Intronic
1014762563 6:125373266-125373288 ATGGAGAAGAAGAGTTTGGGAGG - Intergenic
1014835812 6:126159225-126159247 AAGGGGAAAGAAAGTTTGGAGGG - Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015449817 6:133353388-133353410 ACCTAGAAGCAAAATTTGGAAGG - Intronic
1015800380 6:137055038-137055060 ATGTATATGGAAAATCTGGAGGG + Intergenic
1016643534 6:146378187-146378209 GTGCAGAAGGAAAATGTGGGGGG + Intronic
1016756780 6:147696211-147696233 AAGGAGAAGGCAAGTTTGGAGGG - Intronic
1017266693 6:152454295-152454317 TTGGAGATGGGAACTTTGGAAGG + Intronic
1018096966 6:160396697-160396719 ATGCAGAAGTAAAATTTTGTTGG - Intronic
1018256673 6:161926923-161926945 AAGGAGAAGCAAAATTTAGAGGG - Intronic
1018299559 6:162386753-162386775 ATGGAGAAAGAAAAATTGGTAGG + Intronic
1018477437 6:164157642-164157664 ATGGAGAAGGAAAACGAGGCTGG + Intergenic
1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG + Intergenic
1020524944 7:9247473-9247495 ATGGAGTAGCAAATTTTGGGAGG - Intergenic
1020561031 7:9728685-9728707 ATGAAAAAGAAAAGTTTGGAAGG - Intergenic
1020581398 7:10007269-10007291 ATTGTGAAAGAAAACTTGGAAGG + Intergenic
1021585717 7:22205435-22205457 ATAGAGAAGGAAATTGTGGGTGG - Intronic
1021642111 7:22748212-22748234 ATGGAGAAATAAAAGGTGGATGG + Intergenic
1021796759 7:24263350-24263372 TTGGAGAAGGAAGATTTAGTGGG + Intergenic
1021847715 7:24778882-24778904 AAGGAGAAAATAAATTTGGAGGG + Intergenic
1022131058 7:27405027-27405049 ATGGAGAACCAAAAATAGGAAGG + Intergenic
1022209107 7:28191176-28191198 ATCAGGAAGGAAAATTTTGATGG - Intergenic
1022264370 7:28739686-28739708 TGGGAAAAGGAGAATTTGGAGGG + Intronic
1022290835 7:29000987-29001009 AAGGAGAAGGCTAATTTGGAAGG + Intronic
1022806686 7:33829579-33829601 ATGGAGAAGGAAAAAGGAGAAGG - Intergenic
1023372056 7:39521573-39521595 ATGGAGCAGGAAAACTAAGAGGG + Intergenic
1023694698 7:42832916-42832938 ATGGAGAAGGTGAATATGAAAGG + Intergenic
1024131033 7:46353560-46353582 AAGGAGGAGGAACATTTTGATGG + Intergenic
1024145783 7:46515160-46515182 GAGTAGAAAGAAAATTTGGAGGG + Intergenic
1024459215 7:49642896-49642918 ATGGAGAATGGAGACTTGGAAGG + Intergenic
1024879242 7:54067094-54067116 ATGGAGAAGGAAGACATGAAAGG - Intergenic
1025030777 7:55554953-55554975 ATGGAGAAGGAAAGCTTCCAAGG + Intronic
1025580579 7:62710363-62710385 TTTGTGAAGGAATATTTGGAAGG - Intergenic
1026078891 7:67199575-67199597 ATGCTGAAGGCAAATGTGGAAGG - Intronic
1026697929 7:72612368-72612390 ATGCTGAAGGCAAATGTGGAAGG + Intronic
1027306280 7:76901318-76901340 TTAGAGAAGGAAAATATGGGTGG + Intergenic
1027425406 7:78056883-78056905 ATGGATAAAGAAAATGTGGGAGG - Intronic
1027790153 7:82630101-82630123 AAGGTGAAGGAAAAATTAGAAGG - Intergenic
1027844760 7:83358554-83358576 ATGGATATAGAAAATTTTGATGG - Intergenic
1028011736 7:85653629-85653651 AAGGAGAAGAAAAATTTGGTAGG - Intergenic
1028721942 7:94043054-94043076 AAGGAGAAGAAGAATTTGCAGGG - Intergenic
1029961475 7:104692784-104692806 ATGGAGAAGGAAATTGCAGAAGG + Intronic
1030955298 7:115844570-115844592 ATGGAGAAGCAGGTTTTGGAGGG + Intergenic
1031524270 7:122805594-122805616 AAAGAGAAGGCAATTTTGGAAGG - Intronic
1031701024 7:124926904-124926926 ATGGACAATGGAAACTTGGAGGG + Intronic
1032576375 7:133059411-133059433 ATGGAGGAGGAAAGTGAGGAGGG + Intronic
1032931353 7:136676330-136676352 GTGGATAAAGAAAATGTGGAGGG - Intergenic
1034642865 7:152618705-152618727 TTGGACAATGAATATTTGGAAGG + Intergenic
1036211124 8:6842056-6842078 ATGGAGCAGGAACATTTGGTTGG + Intergenic
1037158974 8:15743917-15743939 AGAGAGATGGAAAATTTTGAGGG + Intronic
1038171466 8:25137614-25137636 GTAGAGAAGGAAAATTTTGAAGG + Intergenic
1038210655 8:25516595-25516617 CTGGAGAAGGTAAATTTGACTGG - Intergenic
1038249086 8:25886036-25886058 ACGGACAGGGAAAATTTGGATGG - Intronic
1038281957 8:26173844-26173866 ATGGAGAAGGTGAGTTTGCAGGG + Intergenic
1038351380 8:26779319-26779341 ATGGAGAAGGAAAATTTGGAAGG - Intronic
1039871512 8:41549678-41549700 ATACAGAAGTAAAAGTTGGATGG - Intergenic
1040293470 8:46137249-46137271 TTGGAGAGGCCAAATTTGGAGGG + Intergenic
1040735427 8:50501306-50501328 AAGGAGAAGGAAAATCTGATTGG - Intronic
1040784839 8:51153765-51153787 ATGGCCAAGGAAAATGTGCAAGG + Intergenic
1041506441 8:58603712-58603734 ATGGAGACAGCACATTTGGAGGG - Intronic
1041529888 8:58853424-58853446 ATGGAAGAGGAAAACTGGGAGGG + Intronic
1041563972 8:59254612-59254634 ATGTAGATGGAAAATCTGTAAGG - Intergenic
1041605061 8:59772319-59772341 AATGAGCAGGAACATTTGGAAGG + Intergenic
1041622978 8:59994930-59994952 ACAGAGAAGGAAAATAAGGAGGG - Intergenic
1041751550 8:61266276-61266298 AAAAAGAAAGAAAATTTGGAGGG - Intronic
1042192494 8:66201629-66201651 GGGGTGAAGGAAAAGTTGGATGG + Intergenic
1042236124 8:66614303-66614325 TTGGCTAAGGAAAATTTGCAAGG + Intergenic
1042485362 8:69340846-69340868 ATGGAGAAAGAACACTAGGATGG + Intergenic
1042622133 8:70718000-70718022 ATGGAGATGAGGAATTTGGAGGG - Intronic
1043509039 8:80931735-80931757 ATAGGGAAGGAAGATTGGGAAGG - Intergenic
1044050005 8:87489381-87489403 ATGTAGAAGAAAAAATTGAAAGG + Intronic
1044111388 8:88279703-88279725 ATGGAAAAACAAAATATGGAGGG + Intronic
1044300122 8:90573900-90573922 AGGAAGAAGGAAAATTTTAATGG - Intergenic
1045040733 8:98221500-98221522 ATGAATATGGAAATTTTGGAGGG + Intronic
1045803265 8:106126573-106126595 AAGTAGAAACAAAATTTGGAGGG + Intergenic
1046065235 8:109188610-109188632 ATGAACATGGTAAATTTGGAGGG - Intergenic
1046376785 8:113393604-113393626 CTGGAGAAGGAAAATGAGAAAGG + Intronic
1046522505 8:115343447-115343469 TTGCAGAAGGAAAATGGGGAAGG - Intergenic
1046677155 8:117122509-117122531 AAGGAGAGGGAAAAGTTGGATGG - Intronic
1046728022 8:117695386-117695408 TTAGAGAAAGAACATTTGGAAGG + Intergenic
1047283851 8:123469426-123469448 ATGGTGTAGGTAAATTTGTAGGG - Intergenic
1047996553 8:130342191-130342213 ATGAAGAAGGCAAATTGGCAAGG + Intronic
1048085112 8:131169011-131169033 ATGTAGAAACAAAATTTGAAGGG - Intergenic
1048207981 8:132430972-132430994 TGGGAGAAGGGAAAATTGGAAGG - Intronic
1049059748 8:140267242-140267264 AAGGGGAAGGACAATTTGTAGGG + Intronic
1049891858 9:76947-76969 ATGGAGAAAGGAAACTTAGAGGG + Intergenic
1050022108 9:1294915-1294937 ACTGAGAAGGAAAATTTTGGAGG - Intergenic
1050086405 9:1970938-1970960 ATGGAGTAGGATAATTAAGATGG + Intergenic
1050255111 9:3785990-3786012 ATGGAGAAGGGAAACTAGAAAGG - Intergenic
1050506409 9:6353596-6353618 AGGCAGAAGGAAACTTTTGAAGG - Intergenic
1050597969 9:7223247-7223269 AAGGAGAATGAAATTTTGGTGGG - Intergenic
1050790494 9:9462790-9462812 ATAGAGATGGAAATTTTGGTGGG + Intronic
1051124700 9:13791209-13791231 ATGGATAAGGAAAATATGTGAGG - Intergenic
1052074619 9:24125521-24125543 AAGGATAGAGAAAATTTGGAGGG + Intergenic
1052515964 9:29480156-29480178 AAGGAAAAGGAAAATAAGGAGGG - Intergenic
1053050844 9:34959045-34959067 ATGGAGAAGAAAAATCCGAATGG - Intronic
1053111594 9:35465224-35465246 ATTGAGAAGGAAAGATTGCATGG + Intergenic
1053138708 9:35668376-35668398 ATGTAGATGAAAAATTTAGAAGG + Intronic
1053229008 9:36389649-36389671 TTGGAGATAAAAAATTTGGAGGG - Intronic
1053290868 9:36878983-36879005 ATGCAGAAGGAAAGAATGGAGGG + Intronic
1053733281 9:41078038-41078060 ATGGAGAAAGGAAACTTAGAGGG + Intergenic
1054676906 9:67864817-67864839 ATTGAAAAGGAGAATTTTGAAGG - Intronic
1054695138 9:68353525-68353547 ATGGAGAAAGGAAACTTAGAGGG - Intronic
1055444891 9:76372799-76372821 ATGGAGAGGGAAAAGCTGTAGGG - Intergenic
1055870013 9:80865609-80865631 ATGGAAAAGAAAAAATTTGAGGG - Intergenic
1056080750 9:83092136-83092158 ATGGAGAGGGATATTTTTGAAGG + Intergenic
1056459243 9:86793225-86793247 ATGGATAAAGAAAATTTTGTGGG - Intergenic
1056838971 9:89982356-89982378 AGGGAGAAGAAAGGTTTGGAAGG - Intergenic
1057739784 9:97701223-97701245 GTGGAGAAGGAAGGTTGGGATGG - Intergenic
1057840964 9:98485286-98485308 ATGGGGTAGGAAAATGGGGAGGG + Intronic
1058364861 9:104197068-104197090 AAGGAGAAGGAACTTTTGGTGGG - Intergenic
1058946982 9:109866512-109866534 ATAGAGAAGAAAAATATGAAGGG + Intronic
1059051869 9:110935179-110935201 ATGAAGATGGAAAGTGTGGATGG + Intronic
1059561472 9:115338830-115338852 AAGGAGAAGGGAAATGTGGAAGG - Intronic
1060386040 9:123229550-123229572 ATGATGCAGGAAAATCTGGAGGG + Intronic
1060644213 9:125264158-125264180 AGGGAGATAAAAAATTTGGATGG + Intronic
1060903837 9:127287025-127287047 GTGGAGAAGGAAAAAGTGCATGG + Intronic
1061590654 9:131595500-131595522 ATGGTGAAGTAAATTGTGGAGGG - Intronic
1061777946 9:132978221-132978243 AGGAAGAAGGAAAATAAGGAAGG + Intronic
1185956207 X:4493714-4493736 AGGCAGGAGGAAAATTTTGAGGG - Intergenic
1186127137 X:6426232-6426254 TTGGAGAAGGCAAAATTCGAGGG + Intergenic
1187220150 X:17317870-17317892 ATGGTGGAGGAAACTTTTGAAGG + Intergenic
1187254748 X:17632145-17632167 AAAGAGAAGGAGAATGTGGAAGG + Intronic
1187371972 X:18716854-18716876 ATTGAGGAGGAAAATGAGGACGG - Intronic
1187571485 X:20508247-20508269 ATGGGGAAGTAAGATTGGGAAGG - Intergenic
1187693367 X:21894179-21894201 AAGGAGAAATAAGATTTGGATGG + Intergenic
1187882315 X:23858782-23858804 ATGGATAAGGTAAATTGTGATGG - Intronic
1188095193 X:26012620-26012642 GTGGAGAAGGGAAAATTAGAGGG + Intergenic
1188520670 X:31034169-31034191 ATGGAGAAGGGAAGATAGGAGGG - Intergenic
1188783322 X:34311916-34311938 CTGAAGAAGGAAAATTTGATAGG - Intergenic
1188817290 X:34731073-34731095 ATTGAGAAAGAAAATTGGGTTGG - Intergenic
1188909603 X:35830300-35830322 ATGGAGATGAACAATCTGGATGG - Intergenic
1189752234 X:44234072-44234094 CTGGTGAGGGAAAATGTGGAAGG - Intronic
1189804389 X:44720636-44720658 ATCGAGAAGGAACAATTGCATGG - Intergenic
1190336915 X:49268270-49268292 ATGGAGAAGGAATGTATGAATGG + Intergenic
1193005244 X:76610155-76610177 ATGGAAAAGGAAACATTGCAGGG + Intergenic
1193173702 X:78367155-78367177 AGGGAGAAGGAGCATTTGTATGG + Intergenic
1193815686 X:86102263-86102285 AAGGAGAAGGAAGACTGGGAAGG + Intergenic
1193987192 X:88257855-88257877 AGTGAGAATGAAAATTTGTAAGG - Intergenic
1194889876 X:99364979-99365001 AAGGGGAAGGAAGAGTTGGAAGG + Intergenic
1194896585 X:99448964-99448986 AAAGACAATGAAAATTTGGAAGG + Intergenic
1195029830 X:100915660-100915682 ATGGATAAAGAAAATCTGGTGGG + Intronic
1195401327 X:104464506-104464528 TGGGAGGAGGAAAATTTGGTTGG + Intergenic
1195413926 X:104599622-104599644 AAGGAAAAGGAAACTTTTGATGG + Intronic
1195444773 X:104939714-104939736 ATGGATAAAGAAAATATGGTAGG + Intronic
1195526248 X:105893385-105893407 GTGAAGAAGCAAAATATGGAGGG - Intronic
1195943051 X:110180842-110180864 ATGGAGAAGGGAAGTGTGGAAGG - Intronic
1196397343 X:115279038-115279060 AGGGAGAAGGCAAATTTGCCTGG + Intergenic
1196471713 X:116036072-116036094 CTGGAAAAGAAAAATCTGGAGGG - Intergenic
1196804551 X:119573174-119573196 TTGGAAAAGGAAATTTTGGGTGG - Intergenic
1197127750 X:122967792-122967814 ATGGTGAAGGAAAATAGGCATGG + Intergenic
1197165272 X:123370245-123370267 AGGGAGAAGGAAAAGTAGGATGG - Intronic
1197211203 X:123829689-123829711 ATGGAGGAGAGAAATTGGGATGG - Intergenic
1198300863 X:135333115-135333137 AGAGAGAAAGAAAATTTGGCTGG + Intronic
1198958859 X:142162284-142162306 ATGGAGATTGAAAAAGTGGAAGG - Intergenic
1198961361 X:142186688-142186710 ATGGAGATTGAAAAAGTGGAAGG - Intergenic
1199340720 X:146674477-146674499 ATAGAGATGGAAAATTTTCAAGG - Intergenic
1199372921 X:147072782-147072804 ATGGAGAAGGAATATGGGGAAGG + Intergenic
1199862742 X:151816441-151816463 TTGGAGAAGGAATAGGTGGAAGG + Intergenic
1199998067 X:153039318-153039340 AGGGAGAAGGAAGGATTGGAAGG - Intergenic
1200297621 X:154938501-154938523 ATGTAGAAAGAAAATATAGAAGG + Intronic
1201109452 Y:10788588-10788610 ATGGTGAAGTCAAATTTGAACGG - Intergenic
1201775421 Y:17658914-17658936 ATGCAAATGGAAATTTTGGAGGG - Intergenic
1201826135 Y:18247075-18247097 ATGCAAATGGAAATTTTGGAGGG + Intergenic
1201981613 Y:19915598-19915620 ACTTAGAAGGACAATTTGGAAGG - Intergenic