ID: 1038351790

View in Genome Browser
Species Human (GRCh38)
Location 8:26782741-26782763
Sequence TGTGCAGGACGGAGCTCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038351790 Original CRISPR TGTGCAGGACGGAGCTCAGG TGG (reversed) Intronic
900324335 1:2100636-2100658 GGTGCAGGACAGGGCACAGGAGG + Intronic
900514424 1:3074568-3074590 TGTGGGGGACGGAGCCCAGCGGG - Intronic
900658151 1:3770318-3770340 TGGTCAGGAAGGAGCCCAGGAGG - Intronic
901701047 1:11044914-11044936 TGGGCAGGCCGGAGCTCCAGGGG + Intronic
902740890 1:18437168-18437190 TGTGGAGGAGGGGGCTTAGGAGG - Intergenic
903655913 1:24948645-24948667 TGTGCAGGACGGGGTGCATGTGG + Intronic
903854551 1:26328983-26329005 CCTGCAGAACTGAGCTCAGGAGG - Intronic
904165407 1:28551551-28551573 TGGGCAGGACAAAGCTCATGAGG - Intergenic
904613304 1:31736822-31736844 TGTGGGGGGCGGGGCTCAGGTGG - Intronic
905473218 1:38208233-38208255 TGAGGAGGACAGAGCCCAGGTGG + Intergenic
905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG + Intronic
908185244 1:61646219-61646241 TCTGCAGCACTGGGCTCAGGAGG + Intergenic
908511075 1:64850425-64850447 AGTGCAGGACTGAACTCTGGAGG + Intronic
915593798 1:156885030-156885052 TGGGCAGGATGGAGATCTGGAGG + Intergenic
919979231 1:202632049-202632071 TCTGCAGGAAGGGGCTGAGGTGG + Intronic
920735604 1:208530393-208530415 AATGCAGGAAGGAGATCAGGAGG + Intergenic
922605158 1:226885583-226885605 TGTTCAGCACGGAGTTGAGGAGG - Exonic
924081160 1:240399839-240399861 TGTGTAAGAAGGAGCTGAGGTGG - Intronic
924384522 1:243489145-243489167 TGTGCAGAACGCGGCGCAGGTGG + Intronic
1067681529 10:48444967-48444989 TCTGGATGCCGGAGCTCAGGAGG - Intergenic
1068874303 10:61980188-61980210 TATGGAGGAAGGGGCTCAGGAGG + Intronic
1069885892 10:71623392-71623414 TGTCCAGGACAGAGCTCAAGAGG + Intronic
1070641729 10:78175268-78175290 TGGGCAGGTAGAAGCTCAGGTGG + Intergenic
1073078870 10:100844041-100844063 TGTGGAGGACGCAGAACAGGAGG - Intergenic
1073295021 10:102433678-102433700 TGTCCATGACAGGGCTCAGGTGG - Intergenic
1075642957 10:124078203-124078225 TGTGCAGGCCTGAGCCAAGGAGG + Intronic
1076732412 10:132445314-132445336 TGCCCAGGACGGAGCTCCAGCGG - Intronic
1077182368 11:1222557-1222579 TGTGCATGCCTGAGCTCAGCAGG + Intergenic
1077233030 11:1467005-1467027 GGTGCAGGTGGGAGCTCAGAGGG - Intergenic
1077638411 11:3859478-3859500 TGTGCATGAGGGACCTCAGGTGG + Intronic
1080304348 11:30820455-30820477 TGGGCAAGAGGGAGCTTAGGTGG - Intergenic
1080465287 11:32490609-32490631 TTTCCAGGCAGGAGCTCAGGAGG - Intergenic
1080617305 11:33955810-33955832 TCTCCAGGATGGAGCTCAGAGGG + Intergenic
1082700032 11:56417663-56417685 TGAGCAGGACAGAGCTAAGAAGG + Exonic
1084365202 11:68693123-68693145 TCTGCAGGACTGAGTGCAGGAGG - Intergenic
1084417976 11:69044444-69044466 GATGCAGGAGGGAGCTCAGAAGG - Intergenic
1084425845 11:69084204-69084226 TGTACAGCAGGGAGCTCGGGTGG + Intronic
1084848012 11:71916076-71916098 TGTTCAGCACAGAGCTCAGAAGG + Exonic
1087013858 11:93537955-93537977 TGGTCAGGCCGGAGGTCAGGTGG - Intronic
1089313264 11:117573976-117573998 AGAGCTGGAGGGAGCTCAGGGGG - Intronic
1090076888 11:123585227-123585249 TGTGAAGGACAGAGCTGAGGAGG + Intronic
1090259487 11:125308370-125308392 TGAGCAGGACTGAGCAGAGGTGG - Intronic
1202811788 11_KI270721v1_random:30224-30246 TGTCCAGGCTGGAGCTCTGGGGG - Intergenic
1093979659 12:25462054-25462076 TTTGCAGGAGGGAGATGAGGGGG + Intronic
1098278281 12:68835591-68835613 TATGCAGGATGGATCTGAGGAGG + Intronic
1102524130 12:113499145-113499167 AGTGCAGGCAGGAGCTCAGGAGG + Intergenic
1104136496 12:125944621-125944643 GGTGCAGGGCGGGGCTGAGGTGG + Intergenic
1105422670 13:20266720-20266742 TGGGAAGGAAGGAGGTCAGGAGG + Intergenic
1107937812 13:45359848-45359870 TCAGGAGGACGCAGCTCAGGAGG + Intergenic
1109981994 13:69921349-69921371 TGTGCAAGACTGAGATCAGCTGG - Intronic
1113488769 13:110676207-110676229 TGTGCAGCACGGGGCACGGGCGG + Intronic
1113585277 13:111460339-111460361 TGAGCAGCACGGACCTCAGGAGG - Intergenic
1115802453 14:37010541-37010563 TGAGCCTGAAGGAGCTCAGGAGG + Intronic
1116334595 14:43640666-43640688 TGTGCAAGTCTGAACTCAGGGGG - Intergenic
1117199086 14:53370386-53370408 TGTGCAGGAGAAAGCTCTGGAGG + Intergenic
1117296687 14:54386852-54386874 TGTGCTGTACAGAGCGCAGGGGG - Intergenic
1117681917 14:58212774-58212796 TCTACAGGACGGAGCTGAGAGGG - Intronic
1119659474 14:76439963-76439985 TGTGCATGGGGGAGCTGAGGGGG - Intronic
1121294955 14:92812823-92812845 GGTTCAGGACAGAGCTTAGGAGG - Intronic
1121454126 14:94027517-94027539 TGTGCAAAACGGTGCTGAGGGGG - Intronic
1122797002 14:104210934-104210956 TCAGCAGGGAGGAGCTCAGGGGG + Intergenic
1123991000 15:25683234-25683256 CGTGGAGGGCAGAGCTCAGGAGG + Intronic
1124494831 15:30180005-30180027 TCTGCAGGAAGGGGCTGAGGTGG + Intergenic
1124748738 15:32358640-32358662 TCTGCAGGAAGGGGCTGAGGTGG - Intergenic
1128511148 15:68314581-68314603 TGTGTAGGAGGGGGCTCTGGAGG - Intronic
1128649502 15:69400297-69400319 TGGGCAGGATGGAGGGCAGGTGG + Intronic
1128722543 15:69961172-69961194 TGTGCTGGACGGTGCTCTGTGGG + Intergenic
1128812137 15:70580428-70580450 TGTGCAGGATGCAGCTCCTGTGG + Intergenic
1129344603 15:74908780-74908802 GGAGGCGGACGGAGCTCAGGTGG + Intergenic
1132221599 15:100109299-100109321 AGTGCAGGACTGAGCTCTGTGGG + Intronic
1132501904 16:288248-288270 TCTGCAGGACGGAGGTGAGGAGG + Exonic
1132616371 16:842886-842908 TGCACAGGACACAGCTCAGGGGG - Intergenic
1132745061 16:1433066-1433088 TGTGCAGGCCGGGCCTCAGCGGG + Intergenic
1133295969 16:4752459-4752481 TGTGCAGGTCGGTGCCCCGGCGG + Exonic
1137003987 16:35255595-35255617 TGGGCGGGGCCGAGCTCAGGGGG - Intergenic
1137583737 16:49651385-49651407 TGTGGAAGATGGAGCTCAGCTGG + Intronic
1138566040 16:57833503-57833525 TGGGCAGGGCTGAGCTCAGAAGG + Intronic
1140263950 16:73404203-73404225 TGTCCAGGACTGAGCTAAGTGGG - Intergenic
1142353728 16:89591373-89591395 CAGGCAGGACAGAGCTCAGGAGG + Intronic
1143553527 17:7646395-7646417 TGTGCAGGTCGCACGTCAGGAGG - Intergenic
1143681077 17:8476505-8476527 TGAGGAGGACGGTGCTGAGGAGG + Intronic
1144580404 17:16455965-16455987 TCTGCAGGAGGGAGCCCTGGAGG - Intronic
1146286218 17:31575733-31575755 TGTGCAGGTTGGAGCCCAGGAGG + Intergenic
1150321430 17:64217512-64217534 TGTCCATGACGGAGCACAGAGGG - Intronic
1150486929 17:65550442-65550464 TGTTCTGGAAGGAGATCAGGAGG - Intronic
1152433939 17:80263862-80263884 TGGGCAGCAGGCAGCTCAGGTGG + Intronic
1152639855 17:81444892-81444914 TGTGCTGGCCAGGGCTCAGGAGG + Intronic
1152679098 17:81656495-81656517 AGTGCAGGGCGGGTCTCAGGGGG + Exonic
1152805648 17:82354563-82354585 TGTTCAGGACAGAGCCCAGGAGG + Intergenic
1152805667 17:82354629-82354651 GGTTCAGGACAGAGCCCAGGAGG + Intergenic
1154299541 18:13181129-13181151 TGGGCAGGAGGGAACTCTGGGGG - Intergenic
1154492385 18:14932032-14932054 TGTGCAGGAGGGAGGTGGGGTGG - Intergenic
1155240144 18:23856947-23856969 TGTGAAGGATGGAGCCCAGAGGG - Intronic
1157552812 18:48593127-48593149 GGTGCAGGAGGAAGCTCAGGCGG + Intronic
1160427086 18:78785895-78785917 TGTGAAGGATGGAGCTGTGGAGG - Intergenic
1160482124 18:79251191-79251213 TGCGCAGGACAGATCACAGGAGG + Intronic
1161012902 19:1968782-1968804 GGTGCAGAGCGGAGCTGAGGAGG - Intronic
1161355051 19:3814390-3814412 TGAGCAGGACATAGCTCAAGAGG + Intronic
1162128650 19:8512352-8512374 AGGGCAGGGCGGAGCTCAAGAGG + Intronic
1165113264 19:33514168-33514190 TGTGCAGGAGGGAGCCCCTGCGG + Intronic
1165846232 19:38819418-38819440 TGTGCAGCCCGGAGGTAAGGCGG - Intronic
1166325238 19:42045910-42045932 TGTGCTAGACTGAGCTCAAGTGG + Intronic
1166438459 19:42789517-42789539 TGTGCAGGACAGGGCTCATCAGG + Intronic
1166494275 19:43287255-43287277 TGTGCAGGACAGGGCTCATCAGG + Intergenic
1166695227 19:44848047-44848069 TGCGCAGAAGAGAGCTCAGGGGG + Intronic
1166749682 19:45158948-45158970 GCTGCAGGACGGAGGGCAGGAGG + Exonic
1166974654 19:46598552-46598574 TGTTCAAGAGGGAGCTGAGGAGG - Intronic
1167196977 19:48036147-48036169 TGTGCAGGGCAGAGCTTTGGAGG + Intronic
1168167695 19:54563107-54563129 TGTCCATCACTGAGCTCAGGAGG - Intergenic
925200513 2:1964754-1964776 TGTGCAGGCTGGAGATAAGGAGG - Intronic
925360824 2:3278837-3278859 TGTGCAGGGAGGAGGTCACGGGG + Intronic
925580504 2:5405832-5405854 TGTGCAGGAAGGAGGGCGGGAGG + Intergenic
928322328 2:30293732-30293754 AGTGGAGGAGGAAGCTCAGGAGG - Intronic
931232044 2:60383210-60383232 TGTTTAGGTCGGAGCACAGGAGG - Intergenic
932058087 2:68467289-68467311 TGAGCAGGGCGGGACTCAGGTGG - Intergenic
932634612 2:73377570-73377592 TGTGAAAGATGAAGCTCAGGGGG - Intergenic
934539010 2:95159454-95159476 TGTGCAGGCCGGAGCTAGGCAGG - Exonic
935182133 2:100700812-100700834 GGTCCAGGAGGGAGCTGAGGTGG - Intergenic
936573088 2:113632643-113632665 TGTGCAGAACTGTGCTCTGGTGG + Intronic
945141047 2:206686502-206686524 TCTGCAGGACTCAGCCCAGGAGG - Intronic
946392728 2:219426249-219426271 TGTGCTGGATGGAGCCCAGGCGG + Exonic
947032094 2:225807902-225807924 TGGGGAGGAAGGAGCTAAGGTGG + Intergenic
947429836 2:230017585-230017607 TGTCAAGGACTGAGCCCAGGAGG - Intergenic
948185485 2:236018395-236018417 TGTGCAGGAGGAAACTCGGGAGG + Intronic
948642493 2:239384574-239384596 TGTGCAGGCCGGAGTGCAGTGGG - Intronic
949042621 2:241856287-241856309 CGTGCAGGATGGAGCTCCGCAGG - Intronic
1170627449 20:18040570-18040592 TGTGGACAATGGAGCTCAGGCGG + Intronic
1171018607 20:21563918-21563940 TGTGGAGGAAGGATCTCAGGTGG + Intergenic
1171111836 20:22491230-22491252 GCAGCAGGAGGGAGCTCAGGGGG - Intergenic
1171140124 20:22733801-22733823 TGTCCAGGTAGGAGATCAGGTGG + Intergenic
1171208327 20:23298369-23298391 TGAGCAGGAAGCAGCTCAGCAGG + Intergenic
1173337242 20:42122715-42122737 TGTGCAAGAGGAAGCTCATGGGG - Intronic
1173579966 20:44140285-44140307 TGTGCAGGCCTGAGCCCAGGGGG + Intronic
1180000426 21:44993078-44993100 TGTCCAGGACGGGGCTCACGGGG - Intergenic
1180048166 21:45319156-45319178 TGTGCAGGCAGCAGGTCAGGTGG + Intergenic
1180091068 21:45534067-45534089 TGAGCAGGACGGAGTGCCGGAGG - Intronic
1180933960 22:19611782-19611804 TGTGCAGGATGGAGCCCAGCAGG - Intergenic
1183352363 22:37341373-37341395 TGTGGAGGACGGAGCTAGGTGGG + Intergenic
1183456252 22:37924814-37924836 TGGGCAGGGCGGGGCTCAGGAGG + Intronic
1183629702 22:39025750-39025772 GGGGCAGGACGGAGGGCAGGAGG - Intronic
1183633153 22:39045621-39045643 GGGGCAGGACGGAGGGCAGGAGG - Intronic
1183927503 22:41216719-41216741 TCAGCAGGCCGGAGCTCAGTTGG + Intronic
1184524309 22:45012792-45012814 GCTGCAGGAGGGATCTCAGGGGG + Intergenic
1185157515 22:49203157-49203179 TGTGGACGGCGGGGCTCAGGTGG - Intergenic
1185207665 22:49549346-49549368 TCTTGAGGACGGAGCTCTGGGGG + Intronic
952877390 3:37957761-37957783 GGTGCAGGACGGTGCTGGGGTGG - Intronic
953746254 3:45576187-45576209 TGTGAAGGAAGGTGCTCAGTTGG - Intronic
953775772 3:45816014-45816036 TGTGCAGGATGTCGATCAGGAGG + Intergenic
953787094 3:45919562-45919584 TGTTCAGGAAGGACCTCAGATGG + Exonic
955440174 3:58946655-58946677 TGTGCAGGACAGAAACCAGGGGG + Intronic
959710359 3:109379655-109379677 TGTGCAGGACTCAGCTAAGCAGG - Intergenic
960355871 3:116652562-116652584 TATTTTGGACGGAGCTCAGGAGG + Intronic
960676012 3:120195486-120195508 TGTGCAGGATGGAGTGCAGTGGG + Intronic
961418097 3:126776466-126776488 TGTGCAGGACTGGTCACAGGTGG - Intronic
961791719 3:129381120-129381142 GGTGCAGGACGGAGCACACAGGG + Intergenic
961795201 3:129403998-129404020 TGTGCAGGACTGGGGTCAGGAGG + Intronic
962714414 3:138114758-138114780 AGTGCAGGACAGGGATCAGGAGG - Intronic
966175219 3:177131391-177131413 TATGCAGTATTGAGCTCAGGAGG - Intronic
968631999 4:1656615-1656637 TGTGCAGGATGAACCCCAGGAGG + Intronic
968635276 4:1675293-1675315 TGTGCTTCCCGGAGCTCAGGTGG - Intronic
968899968 4:3426320-3426342 TGTGCAGGAGAGAGGGCAGGCGG + Intronic
969181708 4:5446865-5446887 GGTGCAGGAAGGAGCACTGGGGG + Intronic
973581966 4:52352786-52352808 TGTGCAGGATGGAGCTGCAGTGG + Intergenic
983919714 4:173333469-173333491 GGAGAGGGACGGAGCTCAGGGGG - Intronic
995399320 5:111722349-111722371 TGTGCAGCCCTGAGCTCAGCTGG + Intronic
997880623 5:137586496-137586518 TGGGCAGGAAGGAGATCAGCAGG + Intronic
998168810 5:139860077-139860099 TGTCAGGGAAGGAGCTCAGGAGG - Intronic
998287394 5:140876546-140876568 TGTGCAAGAGGATGCTCAGGTGG + Exonic
998539814 5:142970149-142970171 TGTGCAGCACTGGGCTCAGTGGG - Intronic
999232212 5:150068378-150068400 TGTGCAGGCCTGACCTCAGGGGG - Intronic
999242103 5:150133688-150133710 TGTGCAGGATGGAGCGGATGTGG + Exonic
1003287097 6:4744111-4744133 TGAGCAGGACGAAGGTCAGATGG + Intronic
1006350061 6:33514358-33514380 TGTGAAGGAAGGGTCTCAGGAGG - Intergenic
1006805402 6:36785234-36785256 TGTGAAGGTTGGAGGTCAGGGGG + Intronic
1007244164 6:40448108-40448130 TGTGAAGGACACTGCTCAGGAGG - Intronic
1009027174 6:58013892-58013914 TGTGCAGTATGGAGCCTAGGAGG - Intergenic
1011700427 6:89950269-89950291 TGTGCAGGACAGGGGCCAGGAGG - Exonic
1012225500 6:96699155-96699177 TGTGCAGGATGGAGCTGTTGGGG - Intergenic
1013317950 6:108959570-108959592 TGTGCAGGAGGGAGGGGAGGCGG + Intronic
1018159637 6:161026077-161026099 AGTGCAGCAGGGAGCACAGGTGG - Intronic
1018203461 6:161415705-161415727 TGTCTGGGACGAAGCTCAGGAGG - Intronic
1018916357 6:168134884-168134906 TGTGCAGGAGGGTGTGCAGGAGG + Intergenic
1019173499 6:170148021-170148043 TGTCCAGGGCCGAGCTCGGGGGG - Intergenic
1019524400 7:1474266-1474288 CGTGCAGGAAGCAGCTCAGGTGG + Exonic
1019674560 7:2303217-2303239 CGTCCAGGAGGGAGGTCAGGGGG + Intronic
1026151368 7:67790610-67790632 TCTGCAGGGCGGCTCTCAGGAGG - Intergenic
1033663024 7:143416180-143416202 TGTACTGGTTGGAGCTCAGGAGG + Intergenic
1034262626 7:149766189-149766211 GGTGGAGGACGAAGATCAGGAGG - Exonic
1034546563 7:151793555-151793577 TGGGCAGGACGGGGTCCAGGTGG - Intronic
1035446771 7:158948494-158948516 TGTGCTGGACTGAGCTCTTGAGG + Intronic
1038351790 8:26782741-26782763 TGTGCAGGACGGAGCTCAGGTGG - Intronic
1039130403 8:34257420-34257442 TGTGCAGAAATGAGCTCAGCTGG + Intergenic
1039956079 8:42208033-42208055 TGTGGTGGCGGGAGCTCAGGGGG + Intergenic
1040943312 8:52854411-52854433 GGTGAAGGACTGAGCTAAGGTGG - Intergenic
1041864038 8:62548115-62548137 TGTGCAGGTAGGAGTCCAGGAGG - Intronic
1045150573 8:99402549-99402571 TCTGCAGGACAGTGCTCTGGTGG - Intronic
1048336927 8:133509575-133509597 TGAGGAGAGCGGAGCTCAGGCGG + Intronic
1049408597 8:142462572-142462594 TGTGCAGGAAGGACGCCAGGAGG + Intronic
1049439460 8:142602582-142602604 TGTCCAGGGCTGAGCTGAGGAGG + Intergenic
1049701709 8:144017547-144017569 AGTGCAGGACAGAGCTCAGATGG + Intronic
1049752932 8:144294121-144294143 GGTGCAGGACGTAGCACTGGGGG + Intronic
1049853952 8:144850011-144850033 TGGGGAGGACGGGGCTCAGGCGG - Intronic
1051518151 9:17953842-17953864 TGGGCAGGACACAGCTGAGGAGG + Intergenic
1057187674 9:93066049-93066071 TGGGCAGGACTGAGATCAGCAGG - Intronic
1059358297 9:113718509-113718531 TGGCCAGGAAGGAGCTAAGGAGG - Intergenic
1060593654 9:124835028-124835050 TGCGTCGGAGGGAGCTCAGGAGG - Intergenic
1061619413 9:131801826-131801848 GATGCAGGGTGGAGCTCAGGAGG - Intergenic
1061925446 9:133803934-133803956 CCTGCAGGACTGTGCTCAGGGGG + Intronic
1061939227 9:133875177-133875199 TGTGCAAGCCGGGGCTCAGGAGG + Intronic
1062413101 9:136434543-136434565 GGTGCAGGTGGGAGCTCTGGGGG + Intronic
1185735402 X:2492001-2492023 TGTCCAGTACAGTGCTCAGGAGG + Intronic
1186205674 X:7197378-7197400 TGTGCAAGAAGGAATTCAGGGGG + Intergenic
1186446048 X:9629884-9629906 GGAGCAGGACGGGGCTCAGTGGG + Intronic
1187414660 X:19082851-19082873 CGTGCAGTAGGGAGCCCAGGGGG - Intronic
1192427022 X:71086239-71086261 TCTGCAGGGCTGAGCTCAGATGG - Intergenic
1197623611 X:128779580-128779602 AGTGCAGGACAGGGCTCAGAAGG - Intergenic
1197941526 X:131795446-131795468 TGAGCAGGACTGAGGTCAGACGG + Intergenic
1199305346 X:146261126-146261148 TGTGCAGGATGGATCTGAAGTGG - Intergenic