ID: 1038353588

View in Genome Browser
Species Human (GRCh38)
Location 8:26805741-26805763
Sequence CTCATCAAGATTCTTGTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038353588_1038353589 -9 Left 1038353588 8:26805741-26805763 CCTGGTACAAGAATCTTGATGAG 0: 1
1: 0
2: 0
3: 11
4: 117
Right 1038353589 8:26805755-26805777 CTTGATGAGCCAAGAGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038353588 Original CRISPR CTCATCAAGATTCTTGTACC AGG (reversed) Intronic
904834447 1:33325776-33325798 CTAATGCAGATTCTGGTACCTGG + Intronic
908703649 1:66927787-66927809 CTCATCATGCTTCTACTACCAGG - Intronic
909720162 1:78758312-78758334 CTCCCAAAGATTTTTGTACCAGG + Intergenic
909987836 1:82184309-82184331 CTCATCAAGGTATTTTTACCTGG - Intergenic
911171689 1:94776694-94776716 CCCTTCAAGCTTCTTGTATCAGG - Intergenic
916160809 1:161911781-161911803 CCCATCAAAATTCTTATCCCAGG - Intronic
916187530 1:162147514-162147536 CACATTATGATTCGTGTACCAGG + Intronic
920882348 1:209892004-209892026 CCCCTCAAGATGCTTGTCCCTGG - Intergenic
920882354 1:209892066-209892088 CCCCTCAAGATGCTTGTCCCTGG - Intergenic
921818254 1:219588196-219588218 ATCATCAAGCTTCTTGTACAAGG + Intergenic
1063586081 10:7353589-7353611 TTCTTCAAGATTCTTGTATGGGG - Intronic
1065833988 10:29640604-29640626 CCCATCAGGAAACTTGTACCTGG + Intronic
1068168851 10:53367297-53367319 CTTATGAAGTTTCTTGTGCCAGG - Intergenic
1068619602 10:59166499-59166521 CTCATCATGAATCTTGAAGCAGG + Intergenic
1070271521 10:74961134-74961156 TTCATTAAAATTCTTTTACCTGG + Intronic
1070620353 10:78004785-78004807 CTCATCACATTTCTTGTAGCCGG + Exonic
1071925702 10:90406557-90406579 CTCCCCATGATTCTTGTTCCAGG + Intergenic
1078971293 11:16414782-16414804 TTCATGTAGTTTCTTGTACCTGG - Intronic
1085571147 11:77558996-77559018 CCCATCTAGATTCCTTTACCCGG - Intronic
1091537116 12:1421681-1421703 CTCATCAAGAGTCATGTAGCTGG - Intronic
1093366867 12:18312690-18312712 CTAATCTAGATTCTTGTCCCTGG - Intronic
1093372449 12:18380662-18380684 CTCAAGAATATTCTTGTAGCAGG - Intronic
1095856634 12:46866926-46866948 CTAATAAAGATTTTTGTACCAGG - Intergenic
1096505129 12:52087860-52087882 CTCCTTGAGAGTCTTGTACCAGG + Intergenic
1097431911 12:59519493-59519515 CTCATACAGATTTTGGTACCAGG - Intergenic
1100135538 12:91548718-91548740 CTCTGCAAGATTTTGGTACCTGG - Intergenic
1104677976 12:130728165-130728187 CTCATCCAGAGCCTTGTGCCAGG + Intergenic
1106209086 13:27624316-27624338 GTCAACATGATTCTGGTACCTGG + Intronic
1108226770 13:48297356-48297378 CTCACCAACATTCTTGCCCCAGG + Intergenic
1109761285 13:66833140-66833162 CTCCTCAAGGTACATGTACCTGG - Intronic
1114181350 14:20370635-20370657 GCTATGAAGATTCTTGTACCCGG + Intronic
1116058504 14:39893664-39893686 CTAATAAAGATTTTGGTACCAGG + Intergenic
1122019741 14:98827855-98827877 CTCATGGAGATACTTGTGCCAGG - Intergenic
1125285962 15:38092806-38092828 CTCATTAAGAATCCTATACCAGG + Intergenic
1127222450 15:56893956-56893978 CTCCTCAAGAATATTGTACCTGG + Intronic
1129180041 15:73868259-73868281 CTCCTCAAGATGCTTGCTCCTGG - Intergenic
1131063574 15:89418930-89418952 CTCATCAGGATTCCTCTTCCAGG - Intergenic
1132400442 15:101501877-101501899 CCCGTCAAGGTTCTTGTGCCTGG - Intronic
1133129309 16:3666449-3666471 CACACCAAGATTTATGTACCAGG + Intronic
1137035272 16:35564700-35564722 CTCACCTAGGTTCTTGTGCCAGG + Intergenic
1138062738 16:53908791-53908813 AGCATGAAGATTCTTGTACGTGG - Intronic
1146850505 17:36217679-36217701 CTAATCCAGATTTTGGTACCAGG + Intronic
1148676166 17:49446231-49446253 CTCATCAAGATTGGTGTCCTGGG + Intronic
1151072175 17:71227194-71227216 CTCATCTAGATTCTTCTTCCAGG - Intergenic
1153666724 18:7372990-7373012 CTACTCTACATTCTTGTACCTGG + Intergenic
1163322675 19:16583696-16583718 TCCATCAACATTCATGTACCAGG - Intronic
1163366819 19:16880105-16880127 GCCATCAAGATTCCTGTACCAGG + Exonic
1164097573 19:22025159-22025181 CTAATACAGATTTTTGTACCAGG - Intergenic
1167482523 19:49741877-49741899 CACAAGAAGATTCTGGTACCAGG - Exonic
930389282 2:50740194-50740216 CTAATCAAGACTCATGTCCCTGG - Intronic
931261051 2:60619838-60619860 CTCATCAAGATAGTTAAACCTGG + Intergenic
933180248 2:79218286-79218308 TTCATGAAGATTCTGGTGCCTGG - Intronic
933599520 2:84315619-84315641 CTCATTAAGACACTTGTACCAGG - Intergenic
933689727 2:85170665-85170687 CTCATAAAGATCTTAGTACCCGG + Intronic
935183639 2:100712548-100712570 CTAATAAAGATTTTGGTACCAGG + Intergenic
935727944 2:106040026-106040048 AACATCAAGGCTCTTGTACCTGG + Intergenic
939900160 2:147841986-147842008 CTTCTCAAGATTCTTCCACCTGG + Intergenic
942500965 2:176590760-176590782 CTCTTCAAGAATCTTCAACCAGG - Intergenic
943227296 2:185194133-185194155 CTCTGCCAGATTCTGGTACCAGG - Intergenic
943386103 2:187205300-187205322 CTAATACAGATTTTTGTACCAGG - Intergenic
946680885 2:222214711-222214733 CTCATAAAGATTTGTGTACTGGG - Intronic
1170352266 20:15454774-15454796 CTCATCAAGTTTCTTGCAGCAGG + Intronic
1170352365 20:15455996-15456018 CTCATCAAGTTTCTTGCAGCAGG + Intronic
1170849385 20:19990512-19990534 GGCAACAAGATTTTTGTACCAGG + Intronic
1173319531 20:41974957-41974979 CTCATCACAACTCTTGAACCAGG - Intergenic
1176950064 21:15033933-15033955 TTCATCAAATTTCTTGTTCCTGG + Intronic
1178761102 21:35403627-35403649 CTCAAAAAGATGCTTGAACCAGG + Intronic
950938946 3:16873920-16873942 TTCATCAAGATTCTCTTTCCAGG - Intronic
952009411 3:28883218-28883240 CTCTTCCACACTCTTGTACCAGG - Intergenic
953031351 3:39181990-39182012 ATCAACAAGATTCATGTACCAGG + Intergenic
959434352 3:106296018-106296040 ATCATAAATATTTTTGTACCAGG + Intergenic
967505697 3:190250462-190250484 CTAATAAAGATTTTGGTACCAGG - Intergenic
973795401 4:54420400-54420422 CTCAACAAGGTTCTGTTACCTGG + Intergenic
974077679 4:57182500-57182522 CTGATCAAGGTTCTTGGCCCTGG - Intergenic
977139811 4:93355128-93355150 CTCCTCAACATTCTTATTCCTGG + Intronic
978863249 4:113476693-113476715 CTGATCAGGAGTCATGTACCTGG + Intronic
979815366 4:125095752-125095774 CTCTTCAAGATTGTTGACCCAGG + Intergenic
981632604 4:146837799-146837821 TTCATCAAAATATTTGTACCTGG - Intronic
987080460 5:14421046-14421068 CTCTCCGATATTCTTGTACCTGG + Intronic
991033078 5:62102341-62102363 CTAATACAGATTCTGGTACCAGG + Intergenic
991419872 5:66429849-66429871 CTCATCTACCTCCTTGTACCAGG - Intergenic
994836737 5:104864981-104865003 CTAATAAAGATTTTGGTACCAGG + Intergenic
996525332 5:124473275-124473297 TTCCTCAATATTATTGTACCAGG + Intergenic
997382423 5:133447156-133447178 CTCACCAAGAGGCTTGTCCCAGG - Intronic
998100290 5:139427454-139427476 TTCTTCATGATTCTTTTACCTGG + Intronic
998655549 5:144174588-144174610 CTCATCAAGTCTCCTGTACTAGG + Intronic
1002665418 5:180820281-180820303 CTCATCCAGACTCTTCTGCCAGG - Intergenic
1005622883 6:27636299-27636321 CTAATACAGATTTTTGTACCAGG - Intergenic
1005817311 6:29564645-29564667 CACATGAATATTCTTGTACATGG - Intronic
1016420393 6:143876561-143876583 CTAATACAGATTTTTGTACCAGG - Intronic
1020683675 7:11267753-11267775 CTCATCAAGATTCATGGAGTAGG + Intergenic
1022573629 7:31476763-31476785 CCCATCCAGATTCTTATATCTGG + Intergenic
1023809851 7:43903563-43903585 CTCCTCAAGTTTCTTTAACCTGG - Intronic
1025759217 7:64374605-64374627 CTAATAAGGACTCTTGTACCTGG + Intergenic
1028335527 7:89649406-89649428 TTCATCAATGTTCTTGTAACTGG + Intergenic
1032753819 7:134869261-134869283 CTCAACAGGTTTCTTGCACCAGG - Intronic
1034261862 7:149762001-149762023 CTTATCAAGGTAGTTGTACCTGG + Intergenic
1034328375 7:150258844-150258866 CTCATCAATAGTCTTTTTCCAGG - Intronic
1034423954 7:151003918-151003940 GTTATGAACATTCTTGTACCCGG + Intronic
1034764839 7:153710620-153710642 CTCATCAATAGTCTTTTTCCAGG + Intergenic
1037760587 8:21739023-21739045 CTCATCAGGATTCTTCTCCTGGG + Intronic
1038353588 8:26805741-26805763 CTCATCAAGATTCTTGTACCAGG - Intronic
1038565464 8:28616654-28616676 CTCTTCAAGATTCTTGCCCAGGG + Intronic
1040375676 8:46822499-46822521 CTAATAACGACTCTTGTACCTGG + Intergenic
1041384186 8:57280639-57280661 CTCATCTGGAGTCTGGTACCAGG - Intergenic
1041828196 8:62122562-62122584 CTCATCATGACCTTTGTACCTGG + Intergenic
1046584511 8:116134691-116134713 CTAATAAAGATTTTGGTACCTGG - Intergenic
1047356244 8:124124928-124124950 GTCATCAAGATTCTGGAATCTGG - Intergenic
1049857036 8:144868827-144868849 CTAATACAGATTTTTGTACCAGG + Intergenic
1050141717 9:2522919-2522941 CTCATCAAGTTACTTGCTCCAGG + Intergenic
1053218690 9:36293684-36293706 CTCATCACGAGTATGGTACCAGG + Intronic
1057837556 9:98457565-98457587 CTCCTCCTGATCCTTGTACCCGG - Intronic
1060454134 9:123774431-123774453 CTGATCAACATTCTTGAACTTGG - Intronic
1062587601 9:137256325-137256347 GTCTTCCAGCTTCTTGTACCTGG - Exonic
1185967315 X:4621971-4621993 CTCATAAAGATTATTGAACTTGG - Intergenic
1186458087 X:9726676-9726698 ATCATGAAGAATCTTGTAACTGG + Intronic
1187694572 X:21905667-21905689 GTCATCAAGGTTATTGTCCCAGG - Intergenic
1190980919 X:55456073-55456095 CTCAGCAAGAGGCTTGCACCTGG - Intergenic
1190987778 X:55517107-55517129 CTCAGCAAGAGGCTTGCACCTGG + Intergenic
1197245514 X:124162602-124162624 CTAATACAGATTTTTGTACCAGG - Intronic
1200844963 Y:7822653-7822675 CTTATGATGACTCTTGTACCTGG - Intergenic
1200850392 Y:7877216-7877238 CTAATAATGACTCTTGTACCTGG - Intergenic
1200866226 Y:8046595-8046617 CTAATAATGACTCTTGTACCTGG + Intergenic
1200870072 Y:8088328-8088350 ATCATCAAGGTTCTTGGACATGG + Intergenic
1200897505 Y:8391287-8391309 CTAATAATGACTCTTGTACCTGG - Intergenic
1200900918 Y:8431064-8431086 CTAATAATGACTCTTGTACCTGG - Intergenic
1202259644 Y:22957073-22957095 CTAATAATGACTCTTGTACCAGG + Intergenic
1202412630 Y:24590817-24590839 CTAATAATGACTCTTGTACCAGG + Intergenic
1202458150 Y:25079253-25079275 CTAATAATGACTCTTGTACCAGG - Intergenic