ID: 1038358834

View in Genome Browser
Species Human (GRCh38)
Location 8:26857231-26857253
Sequence GCTTCAATTGCCAGGCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038358830_1038358834 -4 Left 1038358830 8:26857212-26857234 CCACCAAGACTCACAGCCAGCTT 0: 1
1: 0
2: 1
3: 15
4: 218
Right 1038358834 8:26857231-26857253 GCTTCAATTGCCAGGCAAGCTGG No data
1038358831_1038358834 -7 Left 1038358831 8:26857215-26857237 CCAAGACTCACAGCCAGCTTCAA 0: 1
1: 0
2: 0
3: 18
4: 326
Right 1038358834 8:26857231-26857253 GCTTCAATTGCCAGGCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038358834 Original CRISPR GCTTCAATTGCCAGGCAAGC TGG Intronic
No off target data available for this crispr