ID: 1038360779

View in Genome Browser
Species Human (GRCh38)
Location 8:26873895-26873917
Sequence TTCCCATGCTGTTCTCGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038360779_1038360788 13 Left 1038360779 8:26873895-26873917 CCACCACGAGAACAGCATGGGAA No data
Right 1038360788 8:26873931-26873953 TGATTCAATTTTCTCCCACTGGG No data
1038360779_1038360787 12 Left 1038360779 8:26873895-26873917 CCACCACGAGAACAGCATGGGAA No data
Right 1038360787 8:26873930-26873952 ATGATTCAATTTTCTCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038360779 Original CRISPR TTCCCATGCTGTTCTCGTGG TGG (reversed) Intergenic
No off target data available for this crispr