ID: 1038365492

View in Genome Browser
Species Human (GRCh38)
Location 8:26927827-26927849
Sequence TGGGAAACTTTATGATTAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038365488_1038365492 -7 Left 1038365488 8:26927811-26927833 CCTGCCTCCAACAGAGTGGGAAA No data
Right 1038365492 8:26927827-26927849 TGGGAAACTTTATGATTAATGGG No data
1038365484_1038365492 22 Left 1038365484 8:26927782-26927804 CCTGATGCTTATCTGGGCCTGAA No data
Right 1038365492 8:26927827-26927849 TGGGAAACTTTATGATTAATGGG No data
1038365485_1038365492 5 Left 1038365485 8:26927799-26927821 CCTGAAAAAGTGCCTGCCTCCAA No data
Right 1038365492 8:26927827-26927849 TGGGAAACTTTATGATTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038365492 Original CRISPR TGGGAAACTTTATGATTAAT GGG Intergenic
No off target data available for this crispr