ID: 1038369258

View in Genome Browser
Species Human (GRCh38)
Location 8:26971235-26971257
Sequence CTGTTATAATTAAGGACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038369258_1038369261 29 Left 1038369258 8:26971235-26971257 CCATCTGTCCTTAATTATAACAG No data
Right 1038369261 8:26971287-26971309 ACCCAACCTGCTTCCTTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038369258 Original CRISPR CTGTTATAATTAAGGACAGA TGG (reversed) Intergenic
No off target data available for this crispr