ID: 1038375206

View in Genome Browser
Species Human (GRCh38)
Location 8:27033164-27033186
Sequence GGGTAGGTTAATATGAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038375201_1038375206 3 Left 1038375201 8:27033138-27033160 CCACTTTCAATTGCATGCAAATA No data
Right 1038375206 8:27033164-27033186 GGGTAGGTTAATATGAATTGAGG No data
1038375200_1038375206 4 Left 1038375200 8:27033137-27033159 CCCACTTTCAATTGCATGCAAAT No data
Right 1038375206 8:27033164-27033186 GGGTAGGTTAATATGAATTGAGG No data
1038375199_1038375206 23 Left 1038375199 8:27033118-27033140 CCTTGCAATTATATTTATACCCA No data
Right 1038375206 8:27033164-27033186 GGGTAGGTTAATATGAATTGAGG No data
1038375198_1038375206 29 Left 1038375198 8:27033112-27033134 CCTGCTCCTTGCAATTATATTTA No data
Right 1038375206 8:27033164-27033186 GGGTAGGTTAATATGAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038375206 Original CRISPR GGGTAGGTTAATATGAATTG AGG Intergenic
No off target data available for this crispr