ID: 1038375902

View in Genome Browser
Species Human (GRCh38)
Location 8:27040081-27040103
Sequence GCCAAGAATTACTCTGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038375902_1038375906 15 Left 1038375902 8:27040081-27040103 CCTTTTCCAGAGTAATTCTTGGC No data
Right 1038375906 8:27040119-27040141 CCATTGCCAAAGCCATAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038375902 Original CRISPR GCCAAGAATTACTCTGGAAA AGG (reversed) Intergenic
No off target data available for this crispr