ID: 1038376518

View in Genome Browser
Species Human (GRCh38)
Location 8:27045381-27045403
Sequence GAGCCAACTGTTAAGTTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038376517_1038376518 -7 Left 1038376517 8:27045365-27045387 CCTACACTGGTTTGCAGAGCCAA No data
Right 1038376518 8:27045381-27045403 GAGCCAACTGTTAAGTTTTCAGG No data
1038376516_1038376518 -3 Left 1038376516 8:27045361-27045383 CCAGCCTACACTGGTTTGCAGAG No data
Right 1038376518 8:27045381-27045403 GAGCCAACTGTTAAGTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038376518 Original CRISPR GAGCCAACTGTTAAGTTTTC AGG Intergenic
No off target data available for this crispr