ID: 1038378943

View in Genome Browser
Species Human (GRCh38)
Location 8:27074137-27074159
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038378942_1038378943 -9 Left 1038378942 8:27074123-27074145 CCTCAGAAAGTCTTAGCCCCACC No data
Right 1038378943 8:27074137-27074159 AGCCCCACCCCACCTAGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038378943 Original CRISPR AGCCCCACCCCACCTAGATT AGG Intergenic
No off target data available for this crispr