ID: 1038382510

View in Genome Browser
Species Human (GRCh38)
Location 8:27109825-27109847
Sequence TAAAATGCTGATGGGGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038382510_1038382516 8 Left 1038382510 8:27109825-27109847 CCCTCATCCCCATCAGCATTTTA No data
Right 1038382516 8:27109856-27109878 ATTTCTCTGATGATCATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038382510 Original CRISPR TAAAATGCTGATGGGGATGA GGG (reversed) Intergenic
No off target data available for this crispr