ID: 1038382721

View in Genome Browser
Species Human (GRCh38)
Location 8:27112138-27112160
Sequence GACAATGATGTGAGTTCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038382720_1038382721 6 Left 1038382720 8:27112109-27112131 CCATACTTTACTGAAAAAAACAC No data
Right 1038382721 8:27112138-27112160 GACAATGATGTGAGTTCAACAGG No data
1038382719_1038382721 9 Left 1038382719 8:27112106-27112128 CCTCCATACTTTACTGAAAAAAA No data
Right 1038382721 8:27112138-27112160 GACAATGATGTGAGTTCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038382721 Original CRISPR GACAATGATGTGAGTTCAAC AGG Intergenic
No off target data available for this crispr