ID: 1038383684

View in Genome Browser
Species Human (GRCh38)
Location 8:27120763-27120785
Sequence GGTTCTCTGGGCCATGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038383684_1038383692 16 Left 1038383684 8:27120763-27120785 CCACTCTCATGGCCCAGAGAACC No data
Right 1038383692 8:27120802-27120824 CTGTCTACCTGCACTCAGCAGGG No data
1038383684_1038383691 15 Left 1038383684 8:27120763-27120785 CCACTCTCATGGCCCAGAGAACC No data
Right 1038383691 8:27120801-27120823 GCTGTCTACCTGCACTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038383684 Original CRISPR GGTTCTCTGGGCCATGAGAG TGG (reversed) Intergenic
No off target data available for this crispr