ID: 1038383797

View in Genome Browser
Species Human (GRCh38)
Location 8:27121707-27121729
Sequence TTGGACTGATGCCTCCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038383797_1038383807 16 Left 1038383797 8:27121707-27121729 CCAAGAGGGAGGCATCAGTCCAA No data
Right 1038383807 8:27121746-27121768 GGTTGGAAGAACCAGGGACTAGG No data
1038383797_1038383809 20 Left 1038383797 8:27121707-27121729 CCAAGAGGGAGGCATCAGTCCAA No data
Right 1038383809 8:27121750-27121772 GGAAGAACCAGGGACTAGGGAGG No data
1038383797_1038383800 -5 Left 1038383797 8:27121707-27121729 CCAAGAGGGAGGCATCAGTCCAA No data
Right 1038383800 8:27121725-27121747 TCCAAGGGTAAATCCCTGCTAGG No data
1038383797_1038383806 10 Left 1038383797 8:27121707-27121729 CCAAGAGGGAGGCATCAGTCCAA No data
Right 1038383806 8:27121740-27121762 CTGCTAGGTTGGAAGAACCAGGG No data
1038383797_1038383805 9 Left 1038383797 8:27121707-27121729 CCAAGAGGGAGGCATCAGTCCAA No data
Right 1038383805 8:27121739-27121761 CCTGCTAGGTTGGAAGAACCAGG No data
1038383797_1038383808 17 Left 1038383797 8:27121707-27121729 CCAAGAGGGAGGCATCAGTCCAA No data
Right 1038383808 8:27121747-27121769 GTTGGAAGAACCAGGGACTAGGG No data
1038383797_1038383802 -1 Left 1038383797 8:27121707-27121729 CCAAGAGGGAGGCATCAGTCCAA No data
Right 1038383802 8:27121729-27121751 AGGGTAAATCCCTGCTAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038383797 Original CRISPR TTGGACTGATGCCTCCCTCT TGG (reversed) Intergenic
No off target data available for this crispr