ID: 1038385084

View in Genome Browser
Species Human (GRCh38)
Location 8:27136402-27136424
Sequence GTGAAAAAAATGAAGGTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038385079_1038385084 0 Left 1038385079 8:27136379-27136401 CCTCAATCCTCTGAGCCTAAATA No data
Right 1038385084 8:27136402-27136424 GTGAAAAAAATGAAGGTCAAGGG No data
1038385080_1038385084 -7 Left 1038385080 8:27136386-27136408 CCTCTGAGCCTAAATAGTGAAAA No data
Right 1038385084 8:27136402-27136424 GTGAAAAAAATGAAGGTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038385084 Original CRISPR GTGAAAAAAATGAAGGTCAA GGG Intergenic
No off target data available for this crispr