ID: 1038385084 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:27136402-27136424 |
| Sequence | GTGAAAAAAATGAAGGTCAA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1038385079_1038385084 | 0 | Left | 1038385079 | 8:27136379-27136401 | CCTCAATCCTCTGAGCCTAAATA | No data | ||
| Right | 1038385084 | 8:27136402-27136424 | GTGAAAAAAATGAAGGTCAAGGG | No data | ||||
| 1038385080_1038385084 | -7 | Left | 1038385080 | 8:27136386-27136408 | CCTCTGAGCCTAAATAGTGAAAA | No data | ||
| Right | 1038385084 | 8:27136402-27136424 | GTGAAAAAAATGAAGGTCAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1038385084 | Original CRISPR | GTGAAAAAAATGAAGGTCAA GGG | Intergenic | ||
| No off target data available for this crispr | |||||