ID: 1038388660

View in Genome Browser
Species Human (GRCh38)
Location 8:27174177-27174199
Sequence CAGCCCTCAGGCCTTGCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038388651_1038388660 7 Left 1038388651 8:27174147-27174169 CCTCCTCCTCCTCTTCTCCTCCC No data
Right 1038388660 8:27174177-27174199 CAGCCCTCAGGCCTTGCACTGGG No data
1038388653_1038388660 1 Left 1038388653 8:27174153-27174175 CCTCCTCTTCTCCTCCCTCTTCT No data
Right 1038388660 8:27174177-27174199 CAGCCCTCAGGCCTTGCACTGGG No data
1038388655_1038388660 -10 Left 1038388655 8:27174164-27174186 CCTCCCTCTTCTTCAGCCCTCAG No data
Right 1038388660 8:27174177-27174199 CAGCCCTCAGGCCTTGCACTGGG No data
1038388654_1038388660 -2 Left 1038388654 8:27174156-27174178 CCTCTTCTCCTCCCTCTTCTTCA No data
Right 1038388660 8:27174177-27174199 CAGCCCTCAGGCCTTGCACTGGG No data
1038388652_1038388660 4 Left 1038388652 8:27174150-27174172 CCTCCTCCTCTTCTCCTCCCTCT No data
Right 1038388660 8:27174177-27174199 CAGCCCTCAGGCCTTGCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038388660 Original CRISPR CAGCCCTCAGGCCTTGCACT GGG Intergenic
No off target data available for this crispr