ID: 1038388912

View in Genome Browser
Species Human (GRCh38)
Location 8:27176318-27176340
Sequence CAGTGAGCAGAGATTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038388910_1038388912 -4 Left 1038388910 8:27176299-27176321 CCAGCGATGGGAAGGTAGGCAGT No data
Right 1038388912 8:27176318-27176340 CAGTGAGCAGAGATTGAGGAAGG No data
1038388907_1038388912 2 Left 1038388907 8:27176293-27176315 CCTCTCCCAGCGATGGGAAGGTA No data
Right 1038388912 8:27176318-27176340 CAGTGAGCAGAGATTGAGGAAGG No data
1038388909_1038388912 -3 Left 1038388909 8:27176298-27176320 CCCAGCGATGGGAAGGTAGGCAG No data
Right 1038388912 8:27176318-27176340 CAGTGAGCAGAGATTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038388912 Original CRISPR CAGTGAGCAGAGATTGAGGA AGG Intergenic
No off target data available for this crispr