ID: 1038389260

View in Genome Browser
Species Human (GRCh38)
Location 8:27179976-27179998
Sequence TGCCCACTAGATGCCCATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038389258_1038389260 -4 Left 1038389258 8:27179957-27179979 CCTATGTACTCCAACACATTGCC No data
Right 1038389260 8:27179976-27179998 TGCCCACTAGATGCCCATGTTGG No data
1038389255_1038389260 24 Left 1038389255 8:27179929-27179951 CCAGGAAAATCTGCTACCAGCTG No data
Right 1038389260 8:27179976-27179998 TGCCCACTAGATGCCCATGTTGG No data
1038389257_1038389260 -3 Left 1038389257 8:27179956-27179978 CCCTATGTACTCCAACACATTGC No data
Right 1038389260 8:27179976-27179998 TGCCCACTAGATGCCCATGTTGG No data
1038389254_1038389260 27 Left 1038389254 8:27179926-27179948 CCACCAGGAAAATCTGCTACCAG No data
Right 1038389260 8:27179976-27179998 TGCCCACTAGATGCCCATGTTGG No data
1038389256_1038389260 8 Left 1038389256 8:27179945-27179967 CCAGCTGTTCTCCCTATGTACTC No data
Right 1038389260 8:27179976-27179998 TGCCCACTAGATGCCCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038389260 Original CRISPR TGCCCACTAGATGCCCATGT TGG Intergenic
No off target data available for this crispr