ID: 1038392118

View in Genome Browser
Species Human (GRCh38)
Location 8:27211662-27211684
Sequence ACCAGGGACTTGAGCATCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038392114_1038392118 28 Left 1038392114 8:27211611-27211633 CCACCGGGACTGGTCTTGCACAG No data
Right 1038392118 8:27211662-27211684 ACCAGGGACTTGAGCATCCTTGG No data
1038392115_1038392118 25 Left 1038392115 8:27211614-27211636 CCGGGACTGGTCTTGCACAGTTT No data
Right 1038392118 8:27211662-27211684 ACCAGGGACTTGAGCATCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038392118 Original CRISPR ACCAGGGACTTGAGCATCCT TGG Intergenic
No off target data available for this crispr