ID: 1038395641

View in Genome Browser
Species Human (GRCh38)
Location 8:27243696-27243718
Sequence GGTTTTTGTACCTACCAGCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038395634_1038395641 24 Left 1038395634 8:27243649-27243671 CCATGTTGGGTGAGGGCAGGGGG 0: 1
1: 0
2: 5
3: 38
4: 398
Right 1038395641 8:27243696-27243718 GGTTTTTGTACCTACCAGCAAGG 0: 1
1: 0
2: 0
3: 12
4: 74
1038395637_1038395641 -4 Left 1038395637 8:27243677-27243699 CCTACGCCCCTTAACACATGGTT 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1038395641 8:27243696-27243718 GGTTTTTGTACCTACCAGCAAGG 0: 1
1: 0
2: 0
3: 12
4: 74
1038395638_1038395641 -10 Left 1038395638 8:27243683-27243705 CCCCTTAACACATGGTTTTTGTA 0: 1
1: 0
2: 0
3: 20
4: 243
Right 1038395641 8:27243696-27243718 GGTTTTTGTACCTACCAGCAAGG 0: 1
1: 0
2: 0
3: 12
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038395641 Original CRISPR GGTTTTTGTACCTACCAGCA AGG Exonic
912690431 1:111800817-111800839 GGGCTTTCTACCTGCCAGCATGG - Intronic
915369180 1:155333670-155333692 GGATTTGGTACCTACCACAAAGG + Intergenic
915494714 1:156273644-156273666 ACATTTTGAACCTACCAGCAAGG - Intronic
922368247 1:224886031-224886053 GCTTTTTGTCTCTACCAGGAAGG - Intergenic
923322201 1:232845686-232845708 GGTTTTTTAAACTACCAGGAAGG - Intergenic
1063820799 10:9833052-9833074 GGTACTTTTTCCTACCAGCAAGG + Intergenic
1070287290 10:75093163-75093185 GGTGTTTGCACCTGCCAGGAGGG + Intergenic
1070797817 10:79227263-79227285 GGGTGTTTAACCTACCAGCAAGG - Intronic
1071227169 10:83544048-83544070 TGTTTTAGTACCCACCAGTAGGG + Intergenic
1074452972 10:113574398-113574420 AGATTTGGTACCTACCAGCTTGG - Exonic
1075133793 10:119764256-119764278 GATTTTGGTACCAAGCAGCAGGG - Intronic
1077638083 11:3856764-3856786 GGTTTTAGTACTGAGCAGCATGG + Intronic
1077750877 11:4967538-4967560 GGTTCCTGTACCTACCAGAAAGG + Intronic
1078627265 11:12968867-12968889 CGTTTCTGTGCCAACCAGCAAGG - Intergenic
1088214595 11:107493766-107493788 GGCTTTTGTAGATTCCAGCAAGG - Intergenic
1092357688 12:7810203-7810225 GGTTTCTGCTCCTACCAGGAAGG + Intergenic
1094363612 12:29656853-29656875 AGTTTTTTTTCCTACCAGCAGGG + Intronic
1101016419 12:100505454-100505476 GGGTTCTGTACCTACCAATATGG - Intronic
1102348821 12:112177096-112177118 GGCTGCTGTACCCACCAGCACGG + Intronic
1106305949 13:28509691-28509713 GATTTTTCTACTCACCAGCATGG - Intergenic
1106474769 13:30089102-30089124 GGTTCTTGAACCTGCCAGGAAGG - Intergenic
1111358231 13:87139273-87139295 GGTTTTTTTGCCTAGCTGCATGG - Intergenic
1118456170 14:65947256-65947278 GGTTTTGGCACCTATCAGCAAGG - Intergenic
1121710956 14:96039142-96039164 GGTTCTTGCACCAACCAGCGGGG + Intergenic
1127680528 15:61291862-61291884 GAATTTTATACCTACCAGCACGG - Intergenic
1130204997 15:81867617-81867639 GGCATCTGTCCCTACCAGCAGGG + Intergenic
1131299705 15:91186516-91186538 GGTCATTATACCTACCAACAAGG + Intronic
1132834109 16:1943748-1943770 GTTATTTCAACCTACCAGCAGGG - Intergenic
1134227509 16:12402830-12402852 GGTATTTGTACCCATCAGCCTGG + Intronic
1137036475 16:35573845-35573867 TGTATTTGTACCTGTCAGCATGG + Intergenic
1142084894 16:88172330-88172352 GGTTTGTGTTCCCACCAGCCAGG + Intergenic
1144765049 17:17727999-17728021 GGTTTGTGTGCCTTCCAGCTTGG + Intronic
1149158628 17:53664941-53664963 GAATCTTGGACCTACCAGCAGGG + Intergenic
1150184717 17:63168406-63168428 AGTTTTTCTACCTACCTGCAAGG + Intronic
1158245396 18:55426673-55426695 AGTTTTTGTACTTACATGCAAGG - Intronic
1163243946 19:16080903-16080925 GGTGTTTTTACCTACAAGAAAGG - Intronic
927774181 2:25889189-25889211 TTTATTTGTACCCACCAGCATGG - Intergenic
929863239 2:45696997-45697019 GGCTTTTGTACTTGCCACCAAGG + Intronic
930942351 2:57028103-57028125 GGGTTTTATACCTGCCATCAGGG - Intergenic
939456409 2:142442586-142442608 GGGTTTTGTTCGTACCAACAAGG + Intergenic
944607356 2:201363912-201363934 GGTACTTGTACCTGCCATCAGGG + Intergenic
946850017 2:223896897-223896919 GGTTCTAGTAACTACCAGAATGG - Intronic
1169912597 20:10659281-10659303 TGGTTTTGTAACTACCAGAAAGG - Intronic
1172899406 20:38323487-38323509 GGTTTCTGTGCTTACTAGCAAGG + Intronic
1176582874 21:8548665-8548687 GGTTTTTGCCCCCACCAGCGCGG + Intergenic
1178932597 21:36832795-36832817 CTTTTTTGTACCTACCTTCAAGG - Intronic
1182117832 22:27767475-27767497 GGTTTTTGCACACACCAGTAGGG - Intronic
951325493 3:21297289-21297311 GGTGCTTGTACCTGCCAACAGGG + Intergenic
952626567 3:35412865-35412887 GGATTTTGTAGACACCAGCAAGG - Intergenic
954932207 3:54294103-54294125 GGATTTTGTACTTTCTAGCAAGG + Intronic
955295149 3:57728132-57728154 GGTTTTTGTCCCTAACAGTAGGG - Intergenic
957244618 3:77701837-77701859 CCTTTTTGGACCTTCCAGCAGGG - Intergenic
964836640 3:160946486-160946508 GGTTTTTCCACCTATCTGCAAGG - Intronic
965943703 3:174214563-174214585 TGTTTTGGTACCTACCATCATGG - Intronic
968973315 4:3807965-3807987 GGGTTTTGTCCCTGCCTGCAGGG - Intergenic
972824170 4:42737140-42737162 GGTGTTTATGCCTACCATCAGGG + Intergenic
973263125 4:48185075-48185097 GGTTTTTGTACATTCCATAAGGG - Intronic
975168848 4:71210093-71210115 GCTTTTTGTAACTACCAGTGTGG + Intronic
975541610 4:75518130-75518152 TGTTTTTTTTCCTACCACCAAGG + Intronic
979962489 4:127037094-127037116 GGTGTTTGTACCTGCAACCAGGG + Intergenic
983618967 4:169739504-169739526 GAATTTTATACCTACCAGCATGG + Intronic
996898362 5:128513488-128513510 GGTTTATCTACCTACAGGCAGGG - Intronic
997229907 5:132234690-132234712 GGTTTTTGCACCCACCAGATGGG - Intronic
998483069 5:142479158-142479180 GGTTTCTGTGCCCACCAGTATGG + Intergenic
1000312329 5:160056950-160056972 GGTTTCTGTACCTACATGTATGG - Intronic
1003229737 6:4241212-4241234 GGTTATTATAACTACCAACAGGG + Intergenic
1015058926 6:128938871-128938893 GGTTTTTGGATCAAGCAGCAGGG - Intronic
1015865612 6:137723569-137723591 GGCTTCTCTACCTACCAGCTTGG + Intergenic
1016713164 6:147196222-147196244 TGTTTGTTTACCTGCCAGCAGGG - Intergenic
1018009048 6:159651128-159651150 GTATTTTGTTCCTACCAGAAAGG - Intergenic
1028868463 7:95738907-95738929 GGTGTTTGTGCCTGCCATCAAGG + Intergenic
1029328207 7:99828151-99828173 GGTTCTTGTGGCTACCAGCCTGG + Exonic
1029465723 7:100723477-100723499 TGTTTTCGCACCTACCATCAGGG + Exonic
1032879222 7:136071409-136071431 GGCTTTTGTATATACCAGCAGGG + Intergenic
1037104286 8:15085887-15085909 GGTTTTTGTACCCAACAGGAGGG - Intronic
1037199426 8:16234164-16234186 GGATTCTGTAACTACCAGGAGGG - Intronic
1038395641 8:27243696-27243718 GGTTTTTGTACCTACCAGCAAGG + Exonic
1039628418 8:39080605-39080627 GGCTTTGGTACATACCAGAAGGG - Intronic
1044172037 8:89065844-89065866 GGTTTTTGCACCTGCTGGCATGG + Intergenic
1048457265 8:134589679-134589701 GGCTTTTGTAGCTTCCAGCCTGG - Intronic
1051236882 9:15010288-15010310 GAATTTTATACCTACCAGCATGG - Intergenic
1052961258 9:34299012-34299034 TGTAGTTGTACCTACCAACATGG - Intronic
1057069153 9:92081025-92081047 TGTTGTTGTGCCTACCACCAAGG - Intronic
1186858055 X:13644548-13644570 GATTTTTGTACATACAAGCAAGG + Intergenic
1187726769 X:22211537-22211559 GTATTTTGTTCTTACCAGCATGG + Intronic
1193396653 X:80991317-80991339 GGTTTTTGTCCCTTCCTTCAGGG - Intergenic
1199484571 X:148333898-148333920 GGTTTTTGTGACTTCCAGAATGG - Intergenic